ID: 1076650346

View in Genome Browser
Species Human (GRCh38)
Location 10:131982590-131982612
Sequence TGTCCGGGGCGTCCGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076650340_1076650346 2 Left 1076650340 10:131982565-131982587 CCTGCGTGAACAGCGGGGCCCGT No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650338_1076650346 4 Left 1076650338 10:131982563-131982585 CCCCTGCGTGAACAGCGGGGCCC No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650331_1076650346 17 Left 1076650331 10:131982550-131982572 CCCCGCCGGGGCGCCCCTGCGTG No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650339_1076650346 3 Left 1076650339 10:131982564-131982586 CCCTGCGTGAACAGCGGGGCCCG No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650333_1076650346 15 Left 1076650333 10:131982552-131982574 CCGCCGGGGCGCCCCTGCGTGAA No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650330_1076650346 20 Left 1076650330 10:131982547-131982569 CCGCCCCGCCGGGGCGCCCCTGC No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650334_1076650346 12 Left 1076650334 10:131982555-131982577 CCGGGGCGCCCCTGCGTGAACAG No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650332_1076650346 16 Left 1076650332 10:131982551-131982573 CCCGCCGGGGCGCCCCTGCGTGA No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data
1076650329_1076650346 21 Left 1076650329 10:131982546-131982568 CCCGCCCCGCCGGGGCGCCCCTG No data
Right 1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076650346 Original CRISPR TGTCCGGGGCGTCCGCCCGC AGG Intergenic
No off target data available for this crispr