ID: 1076653839

View in Genome Browser
Species Human (GRCh38)
Location 10:132008205-132008227
Sequence TCCTTGGAATTGAGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076653833_1076653839 17 Left 1076653833 10:132008165-132008187 CCTCTCTTTTTCAGTCTTTCAGT No data
Right 1076653839 10:132008205-132008227 TCCTTGGAATTGAGGGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076653839 Original CRISPR TCCTTGGAATTGAGGGCAAT TGG Intergenic
No off target data available for this crispr