ID: 1076657561

View in Genome Browser
Species Human (GRCh38)
Location 10:132035172-132035194
Sequence CCTTCAAAATATGAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076657561_1076657571 18 Left 1076657561 10:132035172-132035194 CCCCAAAATTCATATTTTGAAGG No data
Right 1076657571 10:132035213-132035235 ACAGGACCTTTAAGGAAGTGAGG No data
1076657561_1076657573 30 Left 1076657561 10:132035172-132035194 CCCCAAAATTCATATTTTGAAGG No data
Right 1076657573 10:132035225-132035247 AGGAAGTGAGGTAACCATCAAGG No data
1076657561_1076657570 10 Left 1076657561 10:132035172-132035194 CCCCAAAATTCATATTTTGAAGG No data
Right 1076657570 10:132035205-132035227 GTTTGCAGACAGGACCTTTAAGG No data
1076657561_1076657566 0 Left 1076657561 10:132035172-132035194 CCCCAAAATTCATATTTTGAAGG No data
Right 1076657566 10:132035195-132035217 CCTAGACCCCGTTTGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076657561 Original CRISPR CCTTCAAAATATGAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr