ID: 1076657733

View in Genome Browser
Species Human (GRCh38)
Location 10:132036067-132036089
Sequence AGCGCGCATCCGTGTGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076657728_1076657733 10 Left 1076657728 10:132036034-132036056 CCAGCTCTGCTGCTCTATCCCAG No data
Right 1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG No data
1076657727_1076657733 28 Left 1076657727 10:132036016-132036038 CCAGCTCTGCAGAGGTCGCCAGC No data
Right 1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG No data
1076657729_1076657733 -8 Left 1076657729 10:132036052-132036074 CCCAGCCTTTCACAAAGCGCGCA No data
Right 1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG No data
1076657726_1076657733 29 Left 1076657726 10:132036015-132036037 CCCAGCTCTGCAGAGGTCGCCAG No data
Right 1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG No data
1076657730_1076657733 -9 Left 1076657730 10:132036053-132036075 CCAGCCTTTCACAAAGCGCGCAT No data
Right 1076657733 10:132036067-132036089 AGCGCGCATCCGTGTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076657733 Original CRISPR AGCGCGCATCCGTGTGGCCG TGG Intergenic
No off target data available for this crispr