ID: 1076658194

View in Genome Browser
Species Human (GRCh38)
Location 10:132037866-132037888
Sequence CTACAGCCCCAGAGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076658194_1076658195 -3 Left 1076658194 10:132037866-132037888 CCAGGGCTGCTCTGGGGCTGTAG No data
Right 1076658195 10:132037886-132037908 TAGAGAACAGCAGTACCAATTGG No data
1076658194_1076658196 8 Left 1076658194 10:132037866-132037888 CCAGGGCTGCTCTGGGGCTGTAG No data
Right 1076658196 10:132037897-132037919 AGTACCAATTGGCCCCGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076658194 Original CRISPR CTACAGCCCCAGAGCAGCCC TGG (reversed) Intergenic
No off target data available for this crispr