ID: 1076658446

View in Genome Browser
Species Human (GRCh38)
Location 10:132039481-132039503
Sequence CCACGCTGTCCAGGGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076658446_1076658458 19 Left 1076658446 10:132039481-132039503 CCCATGGCCCCTGGACAGCGTGG No data
Right 1076658458 10:132039523-132039545 CCTGGCCCTCTACACGTGCCAGG No data
1076658446_1076658455 1 Left 1076658446 10:132039481-132039503 CCCATGGCCCCTGGACAGCGTGG No data
Right 1076658455 10:132039505-132039527 CCCTGCAAGGCTGAGAGGCCTGG No data
1076658446_1076658453 -4 Left 1076658446 10:132039481-132039503 CCCATGGCCCCTGGACAGCGTGG No data
Right 1076658453 10:132039500-132039522 GTGGTCCCTGCAAGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076658446 Original CRISPR CCACGCTGTCCAGGGGCCAT GGG (reversed) Intergenic
No off target data available for this crispr