ID: 1076662630

View in Genome Browser
Species Human (GRCh38)
Location 10:132065563-132065585
Sequence CGAGCGGCAGAGGCCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076662630_1076662635 4 Left 1076662630 10:132065563-132065585 CCAGCCGTGGCCTCTGCCGCTCG No data
Right 1076662635 10:132065590-132065612 TTTTCACGTGAGACTGCCGCCGG No data
1076662630_1076662636 5 Left 1076662630 10:132065563-132065585 CCAGCCGTGGCCTCTGCCGCTCG No data
Right 1076662636 10:132065591-132065613 TTTCACGTGAGACTGCCGCCGGG No data
1076662630_1076662637 14 Left 1076662630 10:132065563-132065585 CCAGCCGTGGCCTCTGCCGCTCG No data
Right 1076662637 10:132065600-132065622 AGACTGCCGCCGGGCCAACCCGG No data
1076662630_1076662639 22 Left 1076662630 10:132065563-132065585 CCAGCCGTGGCCTCTGCCGCTCG No data
Right 1076662639 10:132065608-132065630 GCCGGGCCAACCCGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076662630 Original CRISPR CGAGCGGCAGAGGCCACGGC TGG (reversed) Intergenic