ID: 1076662635

View in Genome Browser
Species Human (GRCh38)
Location 10:132065590-132065612
Sequence TTTTCACGTGAGACTGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076662631_1076662635 0 Left 1076662631 10:132065567-132065589 CCGTGGCCTCTGCCGCTCGCTGG No data
Right 1076662635 10:132065590-132065612 TTTTCACGTGAGACTGCCGCCGG No data
1076662630_1076662635 4 Left 1076662630 10:132065563-132065585 CCAGCCGTGGCCTCTGCCGCTCG No data
Right 1076662635 10:132065590-132065612 TTTTCACGTGAGACTGCCGCCGG No data
1076662633_1076662635 -6 Left 1076662633 10:132065573-132065595 CCTCTGCCGCTCGCTGGTTTTCA No data
Right 1076662635 10:132065590-132065612 TTTTCACGTGAGACTGCCGCCGG No data
1076662629_1076662635 5 Left 1076662629 10:132065562-132065584 CCCAGCCGTGGCCTCTGCCGCTC No data
Right 1076662635 10:132065590-132065612 TTTTCACGTGAGACTGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076662635 Original CRISPR TTTTCACGTGAGACTGCCGC CGG Intergenic