ID: 1076666263

View in Genome Browser
Species Human (GRCh38)
Location 10:132094701-132094723
Sequence CCTCCCAGCAGGAGGCCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666263_1076666272 28 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666263_1076666269 7 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666269 10:132094731-132094753 TTCCAGAGAGCATCTGCTGTGGG No data
1076666263_1076666271 19 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666271 10:132094743-132094765 TCTGCTGTGGGAGCATAGAGAGG No data
1076666263_1076666268 6 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666268 10:132094730-132094752 TTTCCAGAGAGCATCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666263 Original CRISPR CCTCCCAGCAGGAGGCCAAC CGG (reversed) Intergenic
No off target data available for this crispr