ID: 1076666266

View in Genome Browser
Species Human (GRCh38)
Location 10:132094709-132094731
Sequence AAGCTCCACCTCCCAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666266_1076666271 11 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666271 10:132094743-132094765 TCTGCTGTGGGAGCATAGAGAGG No data
1076666266_1076666268 -2 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666268 10:132094730-132094752 TTTCCAGAGAGCATCTGCTGTGG No data
1076666266_1076666273 27 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666273 10:132094759-132094781 AGAGAGGAACCCGCGGTGAGTGG No data
1076666266_1076666274 28 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666274 10:132094760-132094782 GAGAGGAACCCGCGGTGAGTGGG No data
1076666266_1076666269 -1 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666269 10:132094731-132094753 TTCCAGAGAGCATCTGCTGTGGG No data
1076666266_1076666272 20 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666266_1076666275 29 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666275 10:132094761-132094783 AGAGGAACCCGCGGTGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666266 Original CRISPR AAGCTCCACCTCCCAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr