ID: 1076666268

View in Genome Browser
Species Human (GRCh38)
Location 10:132094730-132094752
Sequence TTTCCAGAGAGCATCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666266_1076666268 -2 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666268 10:132094730-132094752 TTTCCAGAGAGCATCTGCTGTGG No data
1076666263_1076666268 6 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666268 10:132094730-132094752 TTTCCAGAGAGCATCTGCTGTGG No data
1076666267_1076666268 -5 Left 1076666267 10:132094712-132094734 CCTGCTGGGAGGTGGAGCTTTCC No data
Right 1076666268 10:132094730-132094752 TTTCCAGAGAGCATCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666268 Original CRISPR TTTCCAGAGAGCATCTGCTG TGG Intergenic
No off target data available for this crispr