ID: 1076666270

View in Genome Browser
Species Human (GRCh38)
Location 10:132094733-132094755
Sequence CTCCCACAGCAGATGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666270_1076666275 5 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666275 10:132094761-132094783 AGAGGAACCCGCGGTGAGTGGGG No data
1076666270_1076666272 -4 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666270_1076666274 4 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666274 10:132094760-132094782 GAGAGGAACCCGCGGTGAGTGGG No data
1076666270_1076666276 11 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666276 10:132094767-132094789 ACCCGCGGTGAGTGGGGCCCTGG No data
1076666270_1076666273 3 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666273 10:132094759-132094781 AGAGAGGAACCCGCGGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666270 Original CRISPR CTCCCACAGCAGATGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr