ID: 1076666272

View in Genome Browser
Species Human (GRCh38)
Location 10:132094752-132094774
Sequence GGAGCATAGAGAGGAACCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666267_1076666272 17 Left 1076666267 10:132094712-132094734 CCTGCTGGGAGGTGGAGCTTTCC No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666263_1076666272 28 Left 1076666263 10:132094701-132094723 CCGGTTGGCCTCCTGCTGGGAGG No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666270_1076666272 -4 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data
1076666266_1076666272 20 Left 1076666266 10:132094709-132094731 CCTCCTGCTGGGAGGTGGAGCTT No data
Right 1076666272 10:132094752-132094774 GGAGCATAGAGAGGAACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666272 Original CRISPR GGAGCATAGAGAGGAACCCG CGG Intergenic
No off target data available for this crispr