ID: 1076666276

View in Genome Browser
Species Human (GRCh38)
Location 10:132094767-132094789
Sequence ACCCGCGGTGAGTGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076666270_1076666276 11 Left 1076666270 10:132094733-132094755 CCAGAGAGCATCTGCTGTGGGAG No data
Right 1076666276 10:132094767-132094789 ACCCGCGGTGAGTGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076666276 Original CRISPR ACCCGCGGTGAGTGGGGCCC TGG Intergenic
No off target data available for this crispr