ID: 1076669386

View in Genome Browser
Species Human (GRCh38)
Location 10:132111352-132111374
Sequence GACCTTGCTGTGCTCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076669386_1076669408 28 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669408 10:132111403-132111425 CTAGAGCCCAGGTAGACATGGGG No data
1076669386_1076669400 0 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669400 10:132111375-132111397 CCAGGGTCGGGGGTGGCTCCAGG No data
1076669386_1076669397 -7 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669397 10:132111368-132111390 CAAGGTCCCAGGGTCGGGGGTGG No data
1076669386_1076669401 3 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669401 10:132111378-132111400 GGGTCGGGGGTGGCTCCAGGTGG No data
1076669386_1076669403 5 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669403 10:132111380-132111402 GTCGGGGGTGGCTCCAGGTGGGG No data
1076669386_1076669407 27 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669407 10:132111402-132111424 GCTAGAGCCCAGGTAGACATGGG No data
1076669386_1076669402 4 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669402 10:132111379-132111401 GGTCGGGGGTGGCTCCAGGTGGG No data
1076669386_1076669406 26 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669406 10:132111401-132111423 GGCTAGAGCCCAGGTAGACATGG No data
1076669386_1076669396 -10 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669396 10:132111365-132111387 CAGCAAGGTCCCAGGGTCGGGGG No data
1076669386_1076669404 17 Left 1076669386 10:132111352-132111374 CCCCCCATGAGCACAGCAAGGTC 0: 1
1: 0
2: 3
3: 10
4: 134
Right 1076669404 10:132111392-132111414 TCCAGGTGGGGCTAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076669386 Original CRISPR GACCTTGCTGTGCTCATGGG GGG (reversed) Intronic
901063542 1:6484804-6484826 GAGCTGGCTGTTCCCATGGGTGG - Intronic
904369962 1:30042166-30042188 GGCCTCCCTGTGCTCTTGGGGGG + Intergenic
905814994 1:40943013-40943035 GACCTTGGTATGCTCATGTATGG - Intergenic
905941768 1:41868673-41868695 TTCCTTGCTGTGCTCATGGGAGG - Intronic
913539244 1:119803131-119803153 GACCCAGCTGTGCTCCTGGATGG - Exonic
915272845 1:154767403-154767425 GACCTTACTGTCCTCTTGAGTGG - Intronic
916846180 1:168652594-168652616 AACCTTGGTTTGCTGATGGGCGG - Intergenic
920043962 1:203121599-203121621 GGGCTGGCTGTGCCCATGGGAGG - Intronic
921164726 1:212498656-212498678 GACCTTTCTGTGGTCGTGGGCGG + Intergenic
924300743 1:242635305-242635327 GACCTTGCTGGGCTCTCAGGGGG - Intergenic
924582871 1:245336465-245336487 GACCTTGATCTGCTCTGGGGAGG + Intronic
924825220 1:247531690-247531712 GAACTTGCCCTGCTCATGGGAGG + Exonic
1067085820 10:43237627-43237649 GTCCCTGCTGTGCTCATCAGAGG + Intronic
1067580750 10:47444027-47444049 GACCATGCTCTGCTCATTGAGGG + Intergenic
1070802179 10:79250308-79250330 GACCTTGCTGTGCCCTGTGGAGG + Intronic
1072458934 10:95602012-95602034 CACCTTGCTGGGCTCAGTGGGGG + Intergenic
1075340656 10:121644733-121644755 GGCCTTGCTGTGCTAATGGTGGG - Intergenic
1076351004 10:129815384-129815406 TAAAGTGCTGTGCTCATGGGAGG - Intergenic
1076669386 10:132111352-132111374 GACCTTGCTGTGCTCATGGGGGG - Intronic
1078836527 11:15035409-15035431 GAGCTTCCTGTGCTCTTGGAGGG - Intronic
1081579984 11:44345577-44345599 GTCCTTGCTTTTCTCCTGGGTGG - Intergenic
1082675502 11:56096146-56096168 GACCTGGGTGTGCACATGGTTGG + Intergenic
1082789098 11:57335279-57335301 CACCTCGCTGTGCTCACGGATGG + Intronic
1083983517 11:66193674-66193696 CACCTTGCTGTGCTGAGAGGAGG - Intronic
1084654018 11:70504888-70504910 TACCCGGGTGTGCTCATGGGAGG - Intronic
1085646491 11:78226832-78226854 GCCCTTGGTGTGGCCATGGGAGG + Exonic
1088513151 11:110599019-110599041 GACCTCCCTGTGCTCTTGTGTGG + Intronic
1089934561 11:122350430-122350452 CACCATGCTTTGCTCATGGTTGG + Intergenic
1090064565 11:123491833-123491855 CACCATGCTGGGCTCAGGGGAGG - Intergenic
1090469447 11:126967292-126967314 GAACTTGCAGTGCTCTTTGGAGG - Intronic
1091912765 12:4245167-4245189 GACCTTTCTGTTCCCATGTGAGG + Intergenic
1095949528 12:47774129-47774151 GCCCTTTCTGTGCTTCTGGGAGG + Intronic
1096611138 12:52802607-52802629 GCCCCTGCCGTGCTCTTGGGTGG + Intergenic
1101259136 12:103011465-103011487 TACATGGCTGTGCTCATTGGTGG - Intergenic
1107045901 13:35991784-35991806 GACCTGGATTTGCTAATGGGGGG - Intronic
1107645047 13:42485490-42485512 GGACTTGCTGTTCTCATGGCAGG - Intergenic
1112175605 13:97020572-97020594 GAGCTTTGGGTGCTCATGGGAGG - Intergenic
1113834626 13:113320531-113320553 GCCCTGGGTCTGCTCATGGGAGG + Intronic
1114469062 14:22946534-22946556 GACCTTGCTGAACTCCTGGAGGG + Exonic
1118090348 14:62468882-62468904 AACCTTTCTGTACTCATAGGAGG - Intergenic
1118492056 14:66270515-66270537 TACCTTTCTGTGCTTATGGCTGG + Intergenic
1123056031 14:105571297-105571319 GACAGTGCTCTGCTCATCGGTGG + Intergenic
1125799954 15:42436930-42436952 GACCCTTCTGTGCTGGTGGGAGG + Intronic
1128207887 15:65869379-65869401 GCCCTTGTTGGGCTCAGGGGCGG + Intronic
1129538881 15:76335487-76335509 GAACTTGGTGTGCGCCTGGGTGG - Intergenic
1129587984 15:76887668-76887690 GGCCTTGCTGAGCTGTTGGGGGG - Intronic
1129882606 15:79017031-79017053 GCCCTTGCTGGGCTCAGGGAGGG + Intronic
1130150548 15:81308360-81308382 GCCCTTGCTGTCCCCAGGGGAGG - Intronic
1133488274 16:6241306-6241328 ATTCTTGCTGTCCTCATGGGTGG + Intronic
1133774153 16:8884644-8884666 CTCCCTGCTGTTCTCATGGGAGG - Intergenic
1133883617 16:9805921-9805943 GACCATTCTGTGCTGATGGCAGG - Intronic
1134079653 16:11316045-11316067 GTCCTTGCTGTCCTCTTGGTGGG + Intronic
1134339532 16:13332600-13332622 TTCCTTGCTGTGCTGATGGAAGG - Intergenic
1135626430 16:23999087-23999109 GACCTTTTTCTGCTCATGGTTGG + Intronic
1137638353 16:50007098-50007120 TCCCTTGCTGTTCTCATGAGAGG + Intergenic
1142000920 16:87663966-87663988 GACTCTTCTGTGCTCATGTGAGG + Intronic
1142541131 17:660394-660416 GACAGTGCTGTGCTGAAGGGAGG - Intronic
1142711893 17:1728009-1728031 GTCCTTGCTCTCCTCCTGGGAGG - Exonic
1142717278 17:1754203-1754225 GACCTCGCTGAGCTCCAGGGTGG - Exonic
1142733841 17:1881984-1882006 GGCCTTGCTGTGCCCCTGTGAGG + Intronic
1143006467 17:3838466-3838488 GCCCTTGCTTCCCTCATGGGCGG - Intronic
1152702038 17:81824064-81824086 GACCTGGTTCTGATCATGGGGGG - Intronic
1158572371 18:58607649-58607671 GATGGTGCTGTGCTGATGGGTGG + Intronic
1160933656 19:1582769-1582791 GTCCTTGCTGGGCTCCAGGGAGG + Intronic
1161837106 19:6655141-6655163 GCCCTTGCTGGGCTGGTGGGAGG - Intergenic
1162489885 19:10985806-10985828 GGCCTTGCTGTCATCAGGGGTGG + Intronic
1163779325 19:19238178-19238200 GGGCTGGCTGTGCTCATGGCTGG + Intronic
1167567255 19:50264478-50264500 GCCCTTGATGGGCTCCTGGGAGG - Intronic
1168291254 19:55358798-55358820 GGGCCTGCTGTGCTCCTGGGAGG + Exonic
925018029 2:546417-546439 TCCCTTGCTGTGCCCATGGCAGG + Intergenic
925035412 2:681396-681418 CCCCTTGCTGTGCTCAGAGGTGG - Intergenic
929095869 2:38262764-38262786 GCCTTTGCTGTGTTCACGGGAGG - Intergenic
932092397 2:68817973-68817995 GACCCTGCCGTGATCATGAGAGG + Exonic
936865587 2:117072854-117072876 GAACATGCTGTCCTCCTGGGGGG - Intergenic
937229188 2:120387519-120387541 GGCCTTGCTTTGCTCATGCCTGG + Intergenic
938109390 2:128553798-128553820 GAGCTTGCTCTGCCCATGTGAGG + Intergenic
945923210 2:215777613-215777635 CACCTTGCTGGGCTCATGTGAGG - Intergenic
948074997 2:235159017-235159039 GACCCTGCCCTGCTCAAGGGTGG - Intergenic
1171385927 20:24769557-24769579 GGCCTTGCAGTGCTCATGAGAGG - Intergenic
1171437484 20:25134600-25134622 GACCTGACTGTGCTCCTGAGAGG - Intergenic
1172346919 20:34209391-34209413 GGCCTTCCTGTGCTCTTGGGTGG + Intronic
1174078492 20:47954587-47954609 GACCTTGCTGGGCTGATGGGAGG + Intergenic
1175034185 20:55984159-55984181 GACCTATCTGTGTTCCTGGGAGG + Intergenic
1175761176 20:61562957-61562979 GACCCAGCCGTGCTCCTGGGAGG - Intronic
1175797338 20:61780143-61780165 GAGCTTGCTGTGCCAAGGGGTGG - Intronic
1176055092 20:63141097-63141119 CACCTTGCTGGGCTCACGTGGGG + Intergenic
1179994457 21:44967542-44967564 GACCCTGCTGTGCTCAGCTGAGG + Intronic
951873580 3:27394732-27394754 CACCTTGATTTGCTCATGGTTGG - Exonic
953660290 3:44887018-44887040 GCACTTGCCGTGCTCATGGCTGG - Intronic
953684743 3:45067898-45067920 AATTTTTCTGTGCTCATGGGTGG + Intergenic
954906305 3:54066182-54066204 GAACGTGCTGTGCGCATGGCAGG - Intergenic
965485258 3:169271260-169271282 GACGTGGCTGTGCTCAGGGCTGG - Intronic
967889351 3:194354095-194354117 GGCCCTGCCTTGCTCATGGGAGG + Intergenic
968197255 3:196717473-196717495 GACTTTGGTGTCCTCAGGGGAGG - Intronic
969041431 4:4299169-4299191 GAGCTTGCTGGGCTCAGGTGTGG - Intronic
970020467 4:11561941-11561963 GAACATTCTATGCTCATGGGTGG + Intergenic
973346224 4:49059640-49059662 TATCTAGCTGGGCTCATGGGTGG + Intronic
975655713 4:76639364-76639386 GACCTTGCTGTGGGCATGAAAGG - Intronic
976767072 4:88608916-88608938 AACCTTGCTGTCTCCATGGGAGG - Intronic
979669698 4:123349119-123349141 GACCTTGCACGGCTCATGAGAGG - Intergenic
980750192 4:137077484-137077506 GATCTTCCTGTGCTCTTGGTGGG - Intergenic
981733398 4:147923313-147923335 GACAATGCACTGCTCATGGGGGG - Intronic
982345455 4:154352841-154352863 GACCTTGTGGAGCTCATGGAGGG + Intronic
984352873 4:178618170-178618192 CACCTTGCTGTGATGATGGTTGG - Intergenic
985509965 5:307978-308000 GACCTTGCTGTGCCCTTGGGTGG + Intronic
986000401 5:3626748-3626770 GACCTTGATGTGTTCTTGAGGGG - Intergenic
986733935 5:10654304-10654326 GCCCCTGCTGTGCACAGGGGTGG + Intergenic
988329629 5:29818623-29818645 GATCTTGCTTTGCTCATTGCTGG - Intergenic
988376984 5:30449377-30449399 GGCATTGCTGTGCTCCTGAGTGG + Intergenic
989659005 5:43778643-43778665 GACAATGCTGTGCTCATAGGTGG + Intergenic
990893335 5:60671439-60671461 TACCTTGCTGTGCTCCTTGGTGG - Intronic
993074492 5:83211430-83211452 AACCTGGTTGTGCTCATGGTTGG + Intronic
996702125 5:126460808-126460830 GGGATTGCTGTGGTCATGGGTGG - Intronic
1001385195 5:171332718-171332740 GAACTTGCTGTGGTAATAGGTGG - Intergenic
1002375150 5:178783452-178783474 GCCCTTGCTGTGCTCGTGTGTGG - Intergenic
1003681872 6:8265028-8265050 ATTCTTGCTGTGCTCCTGGGTGG - Intergenic
1006111681 6:31750461-31750483 GACTTAGCTGTTCTCATTGGCGG + Intronic
1006638869 6:35478636-35478658 GACTCTGCTGGGGTCATGGGAGG - Intronic
1007177981 6:39909444-39909466 GACCTCGCAGTGCACATGTGGGG - Intronic
1008536843 6:52512659-52512681 GGCCTTGCTTAGCTCATGGGTGG - Intronic
1010041606 6:71391304-71391326 GACTTTGGAGTGCTGATGGGAGG + Intergenic
1013182859 6:107732645-107732667 GGCCTTTCTGTGCTCTCGGGAGG + Intronic
1013793660 6:113860350-113860372 CACCTTGCTGGGCTCCTCGGCGG - Exonic
1014300756 6:119678501-119678523 GTCCTTGCTGTGATCATTAGTGG + Intergenic
1017460971 6:154649876-154649898 GAACTTTCTGTGCTCACGGTTGG - Intergenic
1017583090 6:155888482-155888504 GTGCATGCTTTGCTCATGGGTGG + Intergenic
1019037518 6:169073864-169073886 TACCTGCCTGTGCTCCTGGGAGG - Intergenic
1019299195 7:295111-295133 TTCCTTCCTGTGCTCATGGAAGG + Intergenic
1033279399 7:139995138-139995160 GACCATGCTTTGAGCATGGGCGG + Intronic
1033670535 7:143488693-143488715 GGCCTTGCGGTGCCCCTGGGTGG + Intergenic
1034079780 7:148265935-148265957 AAGCTAGCTGTGCTCTTGGGAGG - Intronic
1036696122 8:10976289-10976311 GACCCTGCTGGGGTCTTGGGTGG - Intronic
1036707548 8:11056469-11056491 GACATTTCTGTGCACATGGCAGG + Intronic
1037662620 8:20940637-20940659 GCCCTTGCTGGGCTCCTGGCAGG + Intergenic
1038845278 8:31223145-31223167 GTCCTTCCTGTGCTCACAGGAGG + Intergenic
1038960269 8:32510638-32510660 GACATGGCTGTGCTCATGTTGGG + Intronic
1042483975 8:69331717-69331739 GACCTGGCATTGCACATGGGTGG + Intergenic
1047534298 8:125705101-125705123 GAACTTGCTGTTCTCGTGGCAGG + Intergenic
1049509167 8:143019010-143019032 GACCTTGCAGAGCTCCTGGCCGG + Exonic
1049646439 8:143737945-143737967 GTCCTTGCTGGGCACATGGAAGG - Intergenic
1057263665 9:93600042-93600064 GTCCCTGCTGTGCTTGTGGGTGG + Intronic
1062099115 9:134718858-134718880 GACCTTGCCTTCCTCCTGGGGGG + Intronic
1187835140 X:23424917-23424939 GAACATTCTATGCTCATGGGTGG - Intergenic
1188399941 X:29731811-29731833 GCCCTTGCTGTCTTAATGGGTGG - Intronic
1190170250 X:48106733-48106755 GAGCTTGCTGTCATCCTGGGAGG + Intergenic
1190188159 X:48254093-48254115 GAGCTTGCTGTAATCCTGGGAGG + Intronic
1190657055 X:52621857-52621879 GAGCTTGCTGTCATCCTGGGAGG + Intergenic
1197509015 X:127347285-127347307 TAACTTGGTGTCCTCATGGGTGG + Intergenic