ID: 1076672247

View in Genome Browser
Species Human (GRCh38)
Location 10:132129661-132129683
Sequence CAGGCTCAGGGATCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076672242_1076672247 1 Left 1076672242 10:132129637-132129659 CCCGTGATGAGAGGCACTGATCT No data
Right 1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG No data
1076672241_1076672247 2 Left 1076672241 10:132129636-132129658 CCCCGTGATGAGAGGCACTGATC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG No data
1076672243_1076672247 0 Left 1076672243 10:132129638-132129660 CCGTGATGAGAGGCACTGATCTA 0: 1
1: 0
2: 1
3: 18
4: 223
Right 1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076672247 Original CRISPR CAGGCTCAGGGATCTGCCTG TGG Intronic
No off target data available for this crispr