ID: 1076673105

View in Genome Browser
Species Human (GRCh38)
Location 10:132133843-132133865
Sequence CAGCCTCCTCCCACCAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2065
Summary {0: 1, 1: 0, 2: 5, 3: 133, 4: 1926}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673105_1076673108 14 Left 1076673105 10:132133843-132133865 CCTGGGTTGGTGGGAGGAGGCTG 0: 1
1: 0
2: 5
3: 133
4: 1926
Right 1076673108 10:132133880-132133902 TGCCACCATCTCCAAGCACACGG No data
1076673105_1076673112 27 Left 1076673105 10:132133843-132133865 CCTGGGTTGGTGGGAGGAGGCTG 0: 1
1: 0
2: 5
3: 133
4: 1926
Right 1076673112 10:132133893-132133915 AAGCACACGGCCTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673105 Original CRISPR CAGCCTCCTCCCACCAACCC AGG (reversed) Intronic
Too many off-targets to display for this crispr