ID: 1076673112

View in Genome Browser
Species Human (GRCh38)
Location 10:132133893-132133915
Sequence AAGCACACGGCCTCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673104_1076673112 28 Left 1076673104 10:132133842-132133864 CCCTGGGTTGGTGGGAGGAGGCT 0: 1
1: 0
2: 2
3: 31
4: 346
Right 1076673112 10:132133893-132133915 AAGCACACGGCCTCTGCCTCTGG No data
1076673105_1076673112 27 Left 1076673105 10:132133843-132133865 CCTGGGTTGGTGGGAGGAGGCTG 0: 1
1: 0
2: 5
3: 133
4: 1926
Right 1076673112 10:132133893-132133915 AAGCACACGGCCTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673112 Original CRISPR AAGCACACGGCCTCTGCCTC TGG Intronic
No off target data available for this crispr