ID: 1076673164

View in Genome Browser
Species Human (GRCh38)
Location 10:132134102-132134124
Sequence GCGGAGCGGCAGCAAGGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 253}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673164_1076673172 13 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673164_1076673169 3 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673169 10:132134128-132134150 CATATCCTCTGTCGTGGTTCTGG No data
1076673164_1076673175 16 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673164_1076673174 15 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673164_1076673170 4 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673170 10:132134129-132134151 ATATCCTCTGTCGTGGTTCTGGG No data
1076673164_1076673173 14 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673164_1076673176 30 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673164_1076673168 -3 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673168 10:132134122-132134144 CGCACTCATATCCTCTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673164 Original CRISPR GCGGAGCGGCAGCAAGGAAG CGG (reversed) Intronic
900205636 1:1430962-1430984 GCGGAAGAGAAGCAAGGAAGGGG + Intergenic
900306970 1:2015209-2015231 GCGGAGCTGCAGCAATGGACGGG + Intergenic
900429152 1:2593749-2593771 GCGGAGAAGCAGCCAGGAAGGGG - Intronic
900627227 1:3613972-3613994 GTGGAGAGGCAGGCAGGAAGGGG + Intergenic
900915263 1:5633026-5633048 ACGGAGCGTCAGGAAGGAGGAGG - Intergenic
901040245 1:6359151-6359173 GCTGAGCGGCCTCAGGGAAGCGG + Intronic
901289640 1:8113953-8113975 GCTGACAGGCAGCAAGGAAAGGG - Intergenic
901508384 1:9701003-9701025 GCGGAGAAGCAGGGAGGAAGGGG - Intronic
902702342 1:18181106-18181128 GAGGGGAGGCAGCAAGGAGGAGG - Intronic
903011317 1:20332663-20332685 GGGGAGTGGGAGCAGGGAAGAGG - Intronic
903295830 1:22342670-22342692 GCGGAGTGACAGAAACGAAGTGG + Intergenic
903363666 1:22792913-22792935 GGGGAGCGTCAGCCAGGAACAGG + Intronic
903670920 1:25034840-25034862 GGGGAGGGGCAGCAAAGAACGGG - Intergenic
906745982 1:48222530-48222552 ACGTAGTGGCAGCAAGGAAGAGG + Intergenic
907485632 1:54776162-54776184 GGGGAGCAGAGGCAAGGAAGTGG + Intergenic
908488921 1:64623653-64623675 GCGGAGTGGAAGGTAGGAAGAGG + Intronic
910746529 1:90580786-90580808 GCAAAGAGGGAGCAAGGAAGGGG - Intergenic
912058627 1:105636333-105636355 GCTGAGGGACAGCAAGGAGGAGG - Intergenic
913081222 1:115389043-115389065 GCGAAGCTGCAGCCAGGAAGAGG - Intergenic
918085043 1:181238057-181238079 GGGGAGCGGGAGCTTGGAAGAGG + Intergenic
921152670 1:212414537-212414559 GCCCAGGGGCAGGAAGGAAGCGG - Intronic
923270650 1:232352394-232352416 CCAGAGCGGCAGCAAGGAGGTGG + Intergenic
1063219135 10:3950165-3950187 TCGGAGAGGCAGCCAGGGAGAGG + Intergenic
1063300825 10:4847539-4847561 GCTGAGCAGAAACAAGGAAGGGG - Exonic
1064816825 10:19274818-19274840 GGGGGGAGGCAGGAAGGAAGGGG + Intronic
1066305523 10:34136770-34136792 GAGGAAAGGCTGCAAGGAAGTGG - Intronic
1067454239 10:46404864-46404886 GCTGACAGCCAGCAAGGAAGTGG - Intergenic
1067632964 10:47979768-47979790 GCTGACAGCCAGCAAGGAAGTGG + Intergenic
1070864039 10:79695121-79695143 GTGGAGGAGCAACAAGGAAGTGG - Intergenic
1071630936 10:87217347-87217369 GTGGAGGAGCAACAAGGAAGTGG - Intergenic
1071847871 10:89538076-89538098 GCTGACAGGCAGCATGGAAGTGG + Intronic
1072230303 10:93408910-93408932 GCGGATCTGCAGCACAGAAGGGG + Exonic
1072750371 10:97974669-97974691 GCGGAGGGGCAGAGGGGAAGCGG - Intronic
1074278491 10:112027690-112027712 GCTGAGTGGCATCAAAGAAGAGG + Intergenic
1075263092 10:120979786-120979808 GCGCGGCGGCAGCAGGGACGCGG - Intergenic
1076169540 10:128307953-128307975 GAGGGGCTGCAGCCAGGAAGGGG - Intergenic
1076452475 10:130566290-130566312 GTGGAGCTCCAGCAAGGAAAAGG - Intergenic
1076557830 10:131340880-131340902 GCAGAGCAGAAGGAAGGAAGTGG - Intergenic
1076673164 10:132134102-132134124 GCGGAGCGGCAGCAAGGAAGCGG - Intronic
1076742334 10:132492800-132492822 GAGGAGCAGCAGCGAGGACGGGG - Intergenic
1076764574 10:132626025-132626047 GGGGCGGGGCAGCAGGGAAGAGG - Intronic
1077158742 11:1103119-1103141 GTGGAGTGGAAGCAAGAAAGGGG + Intergenic
1077278315 11:1728410-1728432 GAGGAGGGGCTGCAAGGAGGGGG - Intergenic
1078718128 11:13858975-13858997 CCAGAGCAGAAGCAAGGAAGGGG + Intergenic
1078861565 11:15252523-15252545 GCGGAGAGGCTCCAATGAAGAGG - Intergenic
1078920049 11:15821867-15821889 GCGGGGCAGCAGCAGGGAAAAGG - Intergenic
1079132125 11:17753204-17753226 GCAGAGAGGCAGCAAGGAGCAGG + Intronic
1079282834 11:19103378-19103400 CTGGAGCTGCAGCAAGGTAGAGG - Intergenic
1080362498 11:31532190-31532212 GAAGATGGGCAGCAAGGAAGAGG + Intronic
1081584154 11:44372671-44372693 GTGGAGCTGCGGCTAGGAAGGGG - Intergenic
1083277529 11:61605643-61605665 GCAGGGCGGCAGCAAGGCACCGG - Intergenic
1084051527 11:66603269-66603291 GAGGAGCGGCCTCAAGGCAGGGG - Intronic
1084143464 11:67250186-67250208 GATGAGCTGCAGCATGGAAGTGG - Exonic
1084490757 11:69476895-69476917 CTGGAGAGCCAGCAAGGAAGAGG + Intergenic
1084595698 11:70115696-70115718 GGGGAGGAGCAGCAAGGGAGCGG - Intronic
1084735329 11:71101791-71101813 GCGGTGCGGGAGCTGGGAAGGGG + Intronic
1085621949 11:78044282-78044304 GTGGAGGGGCTGCTAGGAAGGGG + Intronic
1089293965 11:117457177-117457199 GCGGCGCCGCAGCATGGAAAAGG - Intronic
1089631960 11:119789460-119789482 GTGGAGGGGCAGGTAGGAAGAGG + Intergenic
1090988614 11:131795925-131795947 CCTGAGCTGCAGCATGGAAGTGG + Intronic
1092138449 12:6166416-6166438 GTGGAGAGGGAGCATGGAAGGGG - Intergenic
1092528985 12:9328629-9328651 GCGGTGCGGCTGCAGGGGAGAGG + Intergenic
1098179148 12:67827551-67827573 GAGCAGCGGCAACAAGGAAAAGG - Intergenic
1099202192 12:79690308-79690330 TCGGGGCCGCAGGAAGGAAGAGG - Exonic
1101410982 12:104468125-104468147 GAGGCGGGGAAGCAAGGAAGGGG + Intronic
1101667632 12:106833935-106833957 CAAGAGCGGCAGCAAGAAAGAGG - Intronic
1103564047 12:121806565-121806587 GGGAAGGGGCAGCAAGGAGGTGG - Intronic
1104461445 12:128959460-128959482 GTGGGGGGGCAGCAAGGGAGTGG + Intronic
1105437721 13:20391594-20391616 GTGGAGCGGAAGGCAGGAAGAGG + Intergenic
1105922912 13:24982290-24982312 GAGGAGGAGGAGCAAGGAAGTGG + Intergenic
1106504071 13:30356074-30356096 GCTGAGAGGCAGGAAGGAAGAGG - Intergenic
1111616211 13:90664396-90664418 GCAAAGCGGCAGCAAGGCTGGGG + Intergenic
1112065758 13:95790914-95790936 GCAGAGAGCCAGCAAGGAGGCGG + Exonic
1113418742 13:110153280-110153302 GCGGAGCAGAGGCAAGGACGGGG + Intronic
1113548004 13:111169429-111169451 CCGGAGCAGGAGCAAGGGAGTGG + Intronic
1121256573 14:92534702-92534724 GCTGAGGGGCAGCCAGGCAGGGG + Intronic
1125751722 15:42033751-42033773 GCGGGGCGGCAGCAGGGAGAGGG - Intronic
1127962601 15:63900824-63900846 GTGAAGAGGCAGCAAGGAGGCGG + Intergenic
1128089830 15:64911918-64911940 GCGGAGCGGCAGGATGCAGGAGG + Exonic
1128111237 15:65077466-65077488 GCGCGGCGCCAGCAAGGAGGTGG + Exonic
1129298894 15:74614647-74614669 GCGCAGCCGCAGCTCGGAAGCGG + Intronic
1129298954 15:74614793-74614815 GCGGAGCGGTCCCAAGGAGGGGG + Intronic
1129372983 15:75109592-75109614 GGGGCGTGGCAGCAAGGCAGGGG + Intronic
1130018104 15:80202738-80202760 GAGGACCTGCAGCAGGGAAGGGG - Intergenic
1132000882 15:98179136-98179158 GCGGAGCTGCCCCAAGGAGGTGG + Intergenic
1132615749 16:840456-840478 GCAGAGCTGCAGCAAGGAGGGGG - Intergenic
1132648982 16:1012043-1012065 TGGGTGGGGCAGCAAGGAAGAGG - Intergenic
1132653146 16:1030626-1030648 GCGCAGCGGCCGCCAGGGAGCGG - Intergenic
1132763654 16:1523777-1523799 GGGGAGGGGCAGCAAGCCAGGGG - Intronic
1132802412 16:1760946-1760968 GCGGAGGGGGAGCAAAGCAGAGG - Intronic
1133034544 16:3027519-3027541 GCGGAGCGGCTGGGAGGCAGGGG + Intronic
1136498931 16:30660013-30660035 TCCGAGGGGCAGCAAGGAGGGGG + Intronic
1136756466 16:32689015-32689037 GCGGGGAGGCAGCAGGGAGGAGG + Intergenic
1136811645 16:33181358-33181380 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1136818121 16:33291438-33291460 GCGGGGAGGCAGCAGGGAGGAGG - Intronic
1136824685 16:33347967-33347989 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1136829751 16:33446738-33446760 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1138179618 16:54932791-54932813 GCGGAACCGCAGCGAGGACGAGG + Exonic
1140068192 16:71627121-71627143 GCGGCCCGGCCACAAGGAAGGGG - Intronic
1142002648 16:87672190-87672212 GGGAGGCGGCAGCAAGGAGGGGG + Intronic
1142049981 16:87951719-87951741 GGGGTGCGGAAGCGAGGAAGCGG - Intronic
1142299297 16:89247330-89247352 GCGGCGGGACAGCAAGGAAGTGG + Intergenic
1202990223 16_KI270728v1_random:4327-4349 GCGGGGAGGCAGCAGGGAGGAGG - Intergenic
1203058610 16_KI270728v1_random:949369-949391 GCGGGGAGGCAGCAGGGAGGAGG + Intergenic
1142811777 17:2398983-2399005 GGGGAGCGGCAGCGGGCAAGGGG - Intronic
1142882837 17:2894874-2894896 ACGGAGCGGCTGGAAGGGAGGGG - Intronic
1143493408 17:7296599-7296621 GTGGAGGGTCAGCGAGGAAGCGG - Intergenic
1145985993 17:29046669-29046691 GGGGAGTGGCAGCAGGAAAGAGG + Intronic
1146197384 17:30824857-30824879 GCTGTGCCGCAGCACGGAAGAGG - Intergenic
1146686914 17:34847257-34847279 GCTGAGCCCCAGCAAGGAAGGGG + Intergenic
1147042105 17:37727156-37727178 GCAGGGCGGCAGCAAGGAGAAGG - Intronic
1147488696 17:40843486-40843508 GTGGTGCGGCAGAGAGGAAGAGG - Intergenic
1147558488 17:41494902-41494924 GTGGAGGGGCAGCCAGGCAGTGG - Intergenic
1148080626 17:44966186-44966208 GCGGGGCAGCAGCCAGGCAGAGG + Intronic
1148614673 17:48991230-48991252 GGGGAGGGGCAGGGAGGAAGAGG + Intergenic
1148670186 17:49404478-49404500 GGGGAGGGGCAGAGAGGAAGTGG - Exonic
1148671743 17:49415643-49415665 GCGGAGTGGCGGCAGGGAGGAGG - Intronic
1150644888 17:66971771-66971793 GAGGAGAGGGAGCAAGGAAGAGG + Intronic
1151826788 17:76528288-76528310 GCTGAGCGGCTGGCAGGAAGCGG - Exonic
1152390436 17:80001017-80001039 GCTGAGGGGCAGCCAGGGAGGGG + Intronic
1152543121 17:80987037-80987059 TGGCAGCTGCAGCAAGGAAGGGG - Intergenic
1152559710 17:81071941-81071963 GAGGAGAGGCAGCAAGGAAATGG - Intronic
1153924592 18:9824957-9824979 GAAGAGCGGCAGGAAGGACGGGG - Intronic
1158933666 18:62345240-62345262 GCAGAGAGCCAGAAAGGAAGAGG + Intronic
1161206163 19:3042272-3042294 GTGGAGGGGCAGGGAGGAAGGGG + Intronic
1161239351 19:3213393-3213415 GAGGAGGGGGAGAAAGGAAGGGG + Intergenic
1161507231 19:4650490-4650512 CCGGAGCTGCAGGAAGGAGGTGG + Intronic
1163489026 19:17606198-17606220 GCCGAGCGGCAGCCAGCAGGCGG + Exonic
1163636041 19:18437592-18437614 GCGCAGCGGCCGCAAGGTGGGGG - Exonic
1164574713 19:29398990-29399012 GAGGGGTGGCAGGAAGGAAGTGG + Intergenic
1164945705 19:32291505-32291527 GAGGAGGGTCAGCAGGGAAGGGG + Intergenic
1165768456 19:38364854-38364876 GGGGAGAGGCAGAAATGAAGGGG - Intronic
1167249166 19:48391532-48391554 GCGGAGCTGGAGCCGGGAAGAGG + Exonic
1167433971 19:49468574-49468596 GAGGAGAGGCAGGAAGGCAGGGG - Intronic
1168152803 19:54458031-54458053 GCAGAACGGCAGCAGGAAAGGGG - Intronic
925119142 2:1403850-1403872 ACGCAGCGGCAGCATGGAAACGG + Intronic
925306178 2:2849420-2849442 GGGGAAGGGCAGGAAGGAAGGGG - Intergenic
925600714 2:5606387-5606409 GAGGAGTGGCAGCAGGGCAGAGG + Intergenic
926087528 2:10029436-10029458 GCGGCGGGGCAGGAAGGGAGGGG - Intergenic
926498009 2:13616216-13616238 AGGGGGCGGCAGCAAGGCAGAGG - Intergenic
927737332 2:25535259-25535281 ACGGAGTGGCAGCCAGGCAGAGG + Intronic
929843900 2:45501718-45501740 GCAAAGCGGCAGCAAGGCTGGGG + Intronic
929898908 2:45984719-45984741 GGGGGCAGGCAGCAAGGAAGGGG - Intronic
930260578 2:49141438-49141460 GCAGAGCAGGAGCAAGGTAGTGG + Intronic
932362211 2:71118362-71118384 GGGCAGCGGCAGCAAGGAGTGGG - Intronic
932405646 2:71511222-71511244 GCTGGGGGGCAGGAAGGAAGAGG + Intronic
932841657 2:75088735-75088757 GCGGATCGGTGACAAGGAAGGGG + Intronic
933172524 2:79139664-79139686 GCTGATAGCCAGCAAGGAAGTGG - Intergenic
934980289 2:98833844-98833866 GGGGAGTGGCAGGAGGGAAGTGG - Intronic
936444360 2:112584670-112584692 GGGGAGCGGCAGCACGTATGGGG - Intronic
937150501 2:119682782-119682804 GAGGAGAGGCAGCAAGGTGGGGG + Intronic
937318287 2:120945870-120945892 CCAGAGCAGCAGAAAGGAAGTGG + Intronic
937400189 2:121575746-121575768 GAGGAGAGGCAGAAAGGAGGAGG + Intronic
938133390 2:128735651-128735673 GCGGAGGGGCAGCAAGGCCCTGG + Intergenic
940194703 2:151080676-151080698 GCGGAGCAGGAACAAGGGAGAGG + Intergenic
942636899 2:178017584-178017606 GTGGAGAGGAAGGAAGGAAGTGG + Intronic
947194367 2:227546205-227546227 GCGAGGCGGCAGCAAGGCTGGGG - Intronic
947711970 2:232321567-232321589 GAGGAGCGTCAGCAAAGGAGAGG + Intronic
947731218 2:232432703-232432725 GAGGAGCGTCAGCAAAGGAGAGG + Intergenic
947866372 2:233400523-233400545 GAGGAGAGGCAGTTAGGAAGTGG - Intronic
948345294 2:237291493-237291515 CAGGAGCGGCAGCAAGGAGGGGG - Intergenic
1171247182 20:23621053-23621075 GCGGAGCTGCAGCCTGGCAGGGG - Intergenic
1171458514 20:25285377-25285399 GTGGAGCGGGAGGAAGGGAGGGG - Intronic
1172428566 20:34872674-34872696 GCTGAGGGGCCGCAAGGACGAGG - Exonic
1173479422 20:43387586-43387608 CGGAAGCAGCAGCAAGGAAGAGG + Intergenic
1173555833 20:43964955-43964977 GGGGAGCAGAAGCAAGGCAGAGG - Intronic
1174346813 20:49936397-49936419 GCAGAGCGGCAGCAAGATGGCGG + Exonic
1175365538 20:58452596-58452618 GCAGAGCAGCAGAAATGAAGAGG + Intergenic
1175381448 20:58567111-58567133 CTGGAGGGGCAGGAAGGAAGTGG - Intergenic
1176301535 21:5101271-5101293 GGGAAGGGGCTGCAAGGAAGCGG + Intergenic
1177338125 21:19760057-19760079 GCTGAGCAGCACCAAGGACGGGG + Intergenic
1178407258 21:32335005-32335027 GCGGGGCAGCAGCAGGGCAGTGG - Intronic
1179855496 21:44160628-44160650 GGGAAGGGGCTGCAAGGAAGCGG - Intergenic
1179964720 21:44795685-44795707 GCGAAGTGTCAGCAAGGAGGTGG + Intronic
1183154395 22:36063902-36063924 GAGGAGAGGGAGCAAGGGAGAGG - Intergenic
1183287751 22:36978187-36978209 GCGGACCGGAAGGAAGGAGGCGG - Intergenic
1183664028 22:39237117-39237139 GCGGAGGGGGAGCGAGGGAGAGG + Intronic
1184757045 22:46522743-46522765 GGTGAGAGGCAGCAGGGAAGGGG + Intronic
1184922089 22:47612980-47613002 GCTGACTGCCAGCAAGGAAGTGG + Intergenic
1185415286 22:50706058-50706080 GCGGTGGGGCTGCAAAGAAGAGG - Intergenic
954156916 3:48690486-48690508 GGGGAGGGGCAGGGAGGAAGAGG + Intronic
958600016 3:96285362-96285384 GAGGAGCGGGAGAAAGGGAGAGG + Intergenic
966876856 3:184327336-184327358 GCGGAGCTTCAGCAAGGAAGTGG + Exonic
968502081 4:955529-955551 GCGGAGCAGCCGCACGGAGGTGG - Intronic
968665086 4:1816596-1816618 GTGGAGAGGCAGCCAGGCAGAGG + Intronic
968701328 4:2059477-2059499 GCGGCGCGGCAGCGGGGACGCGG - Intergenic
968923694 4:3535936-3535958 GCAGAGCGGCAGCCAGGACAAGG + Intergenic
968975771 4:3821413-3821435 GAGAAGCGTCAGCCAGGAAGGGG + Intergenic
969628418 4:8320625-8320647 GTCCAGGGGCAGCAAGGAAGGGG - Intergenic
972396819 4:38664648-38664670 GCGGAGAGCAAGCAAGGAGGAGG + Intronic
975698511 4:77038908-77038930 GGTGAGCAGCAGCAGGGAAGAGG - Intronic
978565292 4:110074783-110074805 GAGCAGAGGCATCAAGGAAGTGG + Intronic
979410535 4:120373158-120373180 GCGGAGGGGAAGCAAGGAACGGG + Intergenic
982354229 4:154449120-154449142 GCGAAGGGGCAGAAAGGCAGAGG - Intronic
983923343 4:173370838-173370860 GCCGCGCGGCAGAAAGAAAGGGG + Intronic
985688648 5:1295070-1295092 GCGGGGCCGCGGAAAGGAAGGGG + Intergenic
987689884 5:21252872-21252894 GTGAAGAGGCAGCAAGAAAGTGG + Intergenic
990709222 5:58563680-58563702 ACGGGGCGGCAGCCAGGCAGAGG + Intergenic
995853705 5:116572935-116572957 GCGGAGGGGCGGCGAGGGAGCGG + Intronic
997413375 5:133707148-133707170 GGAGAGCAGCAGCAGGGAAGAGG - Intergenic
998139049 5:139689767-139689789 GGGGAGCGGCTGCAAGGGTGAGG + Intergenic
999282511 5:150374763-150374785 GCAGAGCAGCAGCGAGGAATCGG + Exonic
1001273171 5:170331292-170331314 GCGGAACTGGAGCCAGGAAGGGG - Intergenic
1001664561 5:173421731-173421753 GTGAAGAGGCAGCAAGAAAGTGG - Intergenic
1001928664 5:175657790-175657812 GCAGTGTGGCAGAAAGGAAGAGG + Intergenic
1002646436 5:180658838-180658860 GCGGAGCGGCAGGCAGGGCGCGG - Intergenic
1003399828 6:5782394-5782416 GGGGAGGAGGAGCAAGGAAGTGG + Intergenic
1004154932 6:13159139-13159161 GCGGGGCTGGAGGAAGGAAGAGG - Intronic
1005027996 6:21482457-21482479 GAGCAGCTGCAGGAAGGAAGAGG + Intergenic
1005070383 6:21856868-21856890 GCTGACAGCCAGCAAGGAAGTGG + Intergenic
1007274369 6:40662663-40662685 GCAGAGCGGCTGCCTGGAAGAGG - Intergenic
1014750640 6:125252070-125252092 GCAAAGGGGCAGCAAGGGAGTGG - Intronic
1016068652 6:139710710-139710732 GTGGAGTAGAAGCAAGGAAGGGG + Intergenic
1016785354 6:148005511-148005533 GAGGAGGGGAAGGAAGGAAGAGG + Intergenic
1017871296 6:158488847-158488869 GGGGATGGGCAGCAAGGGAGAGG + Intronic
1019210865 6:170403655-170403677 GCTGAGCAACAGCAAGGAAGAGG - Intronic
1019293659 7:262500-262522 GTGGAGGGGCAGCAAGGGTGGGG + Intergenic
1020137787 7:5596236-5596258 GGGGAACGCCAGCCAGGAAGGGG + Intronic
1021797263 7:24268820-24268842 GCAGAGTGGTAGCAGGGAAGGGG - Intergenic
1022180296 7:27912557-27912579 GCAGAGAGGGAGGAAGGAAGAGG + Intronic
1024195566 7:47055353-47055375 GAGGAGGGGCAGCAAGAGAGAGG - Intergenic
1024261964 7:47580175-47580197 GCGCAGCAGCAGCCAGGAACAGG + Intronic
1029020209 7:97357220-97357242 GCTGAGCAGCAGCAAGGAGTGGG + Intergenic
1029361616 7:100092337-100092359 TTGGAGAGGCAGCTAGGAAGTGG + Intergenic
1032466448 7:132148628-132148650 GCAGAGTGGCGACAAGGAAGTGG - Exonic
1032932294 7:136687559-136687581 TTGGTGAGGCAGCAAGGAAGGGG - Intergenic
1034266348 7:149782922-149782944 GCGCAGCAGCAGAAAGGCAGAGG - Intergenic
1034478725 7:151303680-151303702 GCTGAGCAGCAGCCGGGAAGGGG + Intergenic
1034500656 7:151448511-151448533 GCCGGCAGGCAGCAAGGAAGGGG + Intergenic
1035389740 7:158496728-158496750 GTGGAGGGGGTGCAAGGAAGGGG - Intronic
1035389902 7:158497113-158497135 GAGGAGAGGGAGCAGGGAAGGGG - Intronic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1037841617 8:22249159-22249181 GCTGAGCCTCACCAAGGAAGAGG + Exonic
1038397608 8:27258635-27258657 GCGGAGAGGAAGAAAGAAAGAGG + Intergenic
1039948926 8:42152981-42153003 GCGGAGCGGTAGCCAGGCCGCGG + Exonic
1040500030 8:47997701-47997723 CCGGAGAGGAAGCAAGGGAGCGG + Intergenic
1042818964 8:72909420-72909442 GAGGAGCGGCAGGAAGGCACAGG + Intronic
1044421902 8:92006281-92006303 GGGGAGGGGCAGTAAGGGAGAGG + Intronic
1047526848 8:125641274-125641296 GAGGTGAGGCAGCCAGGAAGTGG + Intergenic
1047792346 8:128217118-128217140 CAGGAGAGGAAGCAAGGAAGAGG - Intergenic
1048326886 8:133446786-133446808 ACGGAGCAGGAGCAAGGGAGAGG + Intergenic
1049169063 8:141147179-141147201 GTGAAGTGGCAGCAAGGAAATGG - Intronic
1049744813 8:144258810-144258832 CCGCAGCGGCAGCGAGGATGTGG + Exonic
1053799405 9:41754958-41754980 GCAGAGCGGCAGCCAGGACAAGG + Intergenic
1054145811 9:61560039-61560061 GCAGAGCGGCAGCCAGGACAAGG - Intergenic
1054465553 9:65491143-65491165 GCAGAGCGGCAGCCAGGACAAGG - Intergenic
1054945673 9:70793604-70793626 GCAGAGTGGCAGCCGGGAAGAGG - Intronic
1055497088 9:76866723-76866745 GAGGAGAGGAAGGAAGGAAGTGG + Intronic
1056381761 9:86062655-86062677 GTGGAGGGACAGAAAGGAAGAGG + Intronic
1056495131 9:87148639-87148661 GCGGCGCGGCAGCCAGCGAGAGG + Exonic
1056577991 9:87870575-87870597 CTGGAGCGGCAGCCAGGGAGAGG - Intergenic
1060554395 9:124500757-124500779 GTGGTGGGGCAGCATGGAAGGGG - Intronic
1061048468 9:128180296-128180318 GTGGAGCTGGAGCAAGGAAAGGG - Intronic
1061166476 9:128925669-128925691 GCGCAGTGGCAGCCAGGGAGGGG - Intronic
1061294947 9:129671947-129671969 GGGGAGGGGCAGCACGGAACGGG + Intronic
1061366239 9:130173519-130173541 CCGGAGAGGCTGCAGGGAAGGGG - Intronic
1062432292 9:136531609-136531631 GCTGGGCGGGAGGAAGGAAGGGG - Intronic
1186784735 X:12946886-12946908 GTGGAGCGACAGCAAGGGATGGG + Intergenic
1186823422 X:13314284-13314306 TCGGAGCGGCAGCACAGAAGTGG - Intergenic
1189310319 X:40013706-40013728 GCGGAGCGGGAGCGGGGGAGGGG - Intergenic
1189542292 X:42004711-42004733 GCAAAGCGGCAGCAAGGCTGGGG + Intergenic
1189704241 X:43743851-43743873 GTGGAGCGGCTACATGGAAGGGG + Exonic
1190505363 X:51120085-51120107 GCGGGGTGGCAGCCGGGAAGAGG + Intergenic
1191855267 X:65620300-65620322 GCGGGGCGGCAGCGAGGCTGGGG - Intronic
1192931429 X:75810511-75810533 GCAAGGCGGCAGCAAGGCAGGGG - Intergenic
1193015279 X:76725623-76725645 GCAGGGCGGCAGCCAGGATGGGG - Intergenic
1194573732 X:95585465-95585487 GCTGACAGACAGCAAGGAAGTGG - Intergenic
1197107974 X:122738548-122738570 GTGGAGAGGCAGAAAGGAAGAGG + Intergenic
1199879503 X:151962041-151962063 GCAGAGCAGCAGCACGGTAGTGG - Intronic
1201300195 Y:12498560-12498582 CAGGAGCGGCAGGGAGGAAGAGG - Intergenic