ID: 1076673165

View in Genome Browser
Species Human (GRCh38)
Location 10:132134108-132134130
Sequence ATGAGTGCGGAGCGGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673165_1076673177 25 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673165_1076673170 -2 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673170 10:132134129-132134151 ATATCCTCTGTCGTGGTTCTGGG No data
1076673165_1076673173 8 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673165_1076673169 -3 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673169 10:132134128-132134150 CATATCCTCTGTCGTGGTTCTGG No data
1076673165_1076673172 7 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673165_1076673175 10 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673165_1076673176 24 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673165_1076673174 9 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673165_1076673168 -9 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673168 10:132134122-132134144 CGCACTCATATCCTCTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673165 Original CRISPR ATGAGTGCGGAGCGGCAGCA AGG (reversed) Intronic
900120940 1:1048385-1048407 AGGAGGGCGGGGAGGCAGCAGGG + Intronic
900599862 1:3498348-3498370 GTGAGTGGGGCGGGGCAGCAGGG - Intronic
901004603 1:6165737-6165759 AGGAGGGCGGGGCTGCAGCAGGG + Intronic
901342911 1:8511741-8511763 AGGAGAGCAGTGCGGCAGCAGGG - Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
905885883 1:41491684-41491706 ATGAGTGGGCAGCGGAAGCCAGG - Intergenic
907206315 1:52774909-52774931 ATGAGTTGGGAGCTACAGCATGG - Intronic
907383987 1:54113929-54113951 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907384288 1:54115966-54115988 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
908308477 1:62850521-62850543 ATGAGTTCAAAGAGGCAGCAGGG - Intronic
917240465 1:172942717-172942739 ATGAGAGTGGAGTGCCAGCATGG + Intergenic
918520106 1:185406142-185406164 ATAATTGCAGAGTGGCAGCATGG + Intergenic
923298985 1:232623117-232623139 ATGAGTGAGGAGAGACAGCAGGG - Intergenic
923416195 1:233764247-233764269 ATGAGTGCAGCGGGCCAGCATGG - Intergenic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069720120 10:70544503-70544525 CTGAGTGAGGAGGGGCTGCAGGG + Intronic
1071736187 10:88303490-88303512 ACGAGTGCAGAGCTGCAGTAGGG + Intronic
1073255289 10:102147006-102147028 ATGGGGGCGGAGGGGCAGCTGGG - Exonic
1073582999 10:104684576-104684598 AAGAGGGCTGAGCAGCAGCAGGG - Intronic
1074307472 10:112292383-112292405 CTGAGTGCAGTGGGGCAGCAAGG - Intronic
1076673165 10:132134108-132134130 ATGAGTGCGGAGCGGCAGCAAGG - Intronic
1078519107 11:12049288-12049310 ATGAGAGAGAAGTGGCAGCAGGG + Intergenic
1078580073 11:12532798-12532820 AGGAGTGCGGAAAGCCAGCATGG + Intergenic
1082783373 11:57303261-57303283 ATGAGTCCGGAGAGGCAGGTGGG - Intronic
1083256418 11:61498810-61498832 CGGTGTGAGGAGCGGCAGCAGGG - Intergenic
1087363551 11:97191216-97191238 TTGAGTGCGCAGAGGCAGAATGG - Intergenic
1087854388 11:103074311-103074333 ATTAGTGCAGAGAGGCAGAAGGG - Intronic
1088537264 11:110874892-110874914 ATGAGTGTGGAGCAGCAGAGCGG + Intergenic
1091068607 11:132542077-132542099 ATCAGTGCGGAGTGTGAGCAGGG + Intronic
1091222312 11:133936704-133936726 CTGAGTGCCGAGCAGCAGCCTGG - Intronic
1091333449 11:134749238-134749260 ATGAGGGAGGAGCTGCAGGAGGG - Intergenic
1092528983 12:9328623-9328645 ATGAGGGCGGTGCGGCTGCAGGG + Intergenic
1093688355 12:22082231-22082253 ATCAGGGCGGAGTGGCAGGAAGG - Intronic
1094137650 12:27145898-27145920 ATGACTGCTGAGAAGCAGCACGG + Intergenic
1094187071 12:27655633-27655655 ATGACTGCTGAGAAGCAGCACGG + Intronic
1096081991 12:48839708-48839730 CTGAGAGCGGAGTGTCAGCAGGG - Intronic
1099602135 12:84753883-84753905 ATGAGTGCAGCGGGCCAGCATGG + Intergenic
1100506947 12:95230762-95230784 ATGAATGCAGAGCAGAAGCAAGG - Intronic
1101175604 12:102147628-102147650 ATGGGTGCGGCGCACCAGCATGG + Intronic
1102390461 12:112545172-112545194 ATGAGGGGGGTGCGGCTGCAAGG - Intergenic
1105752355 13:23433316-23433338 GTGGGTGAGGAGCGGCTGCAGGG - Intronic
1105785700 13:23747048-23747070 AGGAGTGCTGTGGGGCAGCAGGG + Intronic
1110278957 13:73670496-73670518 TTGTCTGCGGAGCAGCAGCATGG + Intergenic
1112452670 13:99526192-99526214 AGGAGTGTGGAGCGGCTGCTAGG + Intronic
1114059116 14:19002715-19002737 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
1114103426 14:19399039-19399061 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1123220602 14:106851785-106851807 AAGAGTGCGGAGGGACAACAGGG - Intergenic
1202836386 14_GL000009v2_random:80251-80273 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
1123496692 15:20833920-20833942 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1123553928 15:21407512-21407534 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1123590171 15:21844877-21844899 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1127898570 15:63324052-63324074 ATGAGTGCGGATCCGAAGAAAGG + Exonic
1129251917 15:74313925-74313947 ATGAGACTGGAGCGGCTGCAGGG - Intronic
1130484094 15:84388125-84388147 ATGAGTGCAGCGCACCAGCATGG - Intergenic
1202962274 15_KI270727v1_random:134708-134730 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1132603996 16:786062-786084 AGGAGTGCGGAGGGGCTGCCTGG + Exonic
1137612604 16:49828966-49828988 ATGAGGGCCCAGCGGGAGCAGGG - Intronic
1137923960 16:52521811-52521833 CTGGGTGTGGAGCGGCAACATGG + Intronic
1142577853 17:921321-921343 GTGAGTGCGGAGAGGGAGCCGGG - Intronic
1149639537 17:58193832-58193854 GTGCGTGCGGGGCGGCAGGAGGG + Intronic
1149942841 17:60888971-60888993 ATGACTAGGGAGTGGCAGCAGGG + Intronic
1150768301 17:68020152-68020174 ATGGGCCCGGAGCGGCCGCAAGG + Intergenic
1151258781 17:72900496-72900518 ATGAGTCCAGAGGGGCAGCCAGG + Intronic
1152009035 17:77699545-77699567 TTGGGTGAGGAGCCGCAGCATGG + Intergenic
1154454602 18:14509604-14509626 ATCAGTGGAGAGCTGCAGCAAGG - Intronic
1157582283 18:48780704-48780726 TTGTGTGCGGACCGGCAGGAGGG - Intronic
1157782088 18:50448601-50448623 ATGAGTGTGCAGAGACAGCAGGG - Intergenic
1162413384 19:10519311-10519333 AGGAGTGTGGAGTGGCAGCTAGG - Intergenic
1166196181 19:41207330-41207352 GTGTGTGTGGAGGGGCAGCAGGG - Exonic
1167600392 19:50451429-50451451 ATGAGTGGGGAGAGGAAGGAGGG + Intronic
1202636254 1_KI270706v1_random:47114-47136 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
924971499 2:132098-132120 AGAAGTGCAAAGCGGCAGCAGGG + Intergenic
927906842 2:26864704-26864726 ATGAGTGTGAAGCTGCAGGAAGG + Intronic
929601575 2:43207826-43207848 ATGAGTGTGCAGTGGCAGGAGGG + Intergenic
932454900 2:71843358-71843380 ATGAGTGCTGATGGGCAGGAAGG - Intergenic
932555905 2:72825161-72825183 ATAACTGGGGGGCGGCAGCAGGG + Intronic
932751700 2:74375464-74375486 GTGAGTGCAGAAGGGCAGCATGG + Intronic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
938133389 2:128735645-128735667 GTGGGCGCGGAGGGGCAGCAAGG + Intergenic
938282066 2:130071515-130071537 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
938332692 2:130460087-130460109 ATCAGTGGAGAGCTGCAGCAAGG - Exonic
938357115 2:130660584-130660606 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
938391427 2:130909512-130909534 AGGAGTGAGGAGAGGCAGAAGGG + Intronic
938433549 2:131267390-131267412 ATCAGTGGAGAGCTGCAGCAAGG + Intronic
938477587 2:131629975-131629997 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
941918901 2:170830080-170830102 ATGAGTGTTGTGGGGCAGCAGGG - Intronic
942967922 2:181919423-181919445 ATGAGTGCGGAGGAGCGGAAGGG - Exonic
1170612855 20:17928767-17928789 AAAGGTGCGGAGCGGCAGGAAGG + Intergenic
1171882385 20:30628053-30628075 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1173709174 20:45139551-45139573 AGGAGTGCAGAGAGGCAGAACGG - Intergenic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1175457785 20:59128360-59128382 ATGACTGGGGAGGGACAGCAGGG - Intergenic
1176021587 20:62965035-62965057 ATGGCTGCAGAGGGGCAGCAGGG - Intronic
1177717027 21:24852107-24852129 ATGAGTGCAGCACAGCAGCATGG + Intergenic
1179928257 21:44550327-44550349 CTGGGTGCGGAGAGTCAGCACGG + Intronic
1179939428 21:44628386-44628408 CTGGGTGCGGAGAGTCAGCACGG - Intronic
1180364612 22:11927217-11927239 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1180405201 22:12545930-12545952 GTGGGTGCGGTGCAGCAGCATGG + Intergenic
1180477600 22:15725331-15725353 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
1182101895 22:27663265-27663287 AGGAATGAGGAGCGGCAGGAAGG - Intergenic
1183779321 22:39988703-39988725 AGGAGTGGGGAGTGGCAGCAGGG + Intergenic
1184373496 22:44097478-44097500 ATGAATGCTGACAGGCAGCAAGG + Intronic
1184550941 22:45203822-45203844 GTGAGTGCGGGGCGGCCTCACGG - Intronic
1185338944 22:50283152-50283174 CTCAGTGTGGAGCCGCAGCAGGG - Exonic
957244173 3:77697072-77697094 ATGGGTGCTGAGCGGCTTCATGG - Intergenic
961504684 3:127362359-127362381 ATGAGGACAGAGAGGCAGCAGGG - Intergenic
961621538 3:128228450-128228472 CTGAGTGAGGAGCTGAAGCATGG + Intronic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
964031066 3:152139463-152139485 AAGACTGTGGAGAGGCAGCATGG + Intergenic
968046895 3:195629530-195629552 CTGAGTGCCCAGCGTCAGCATGG + Intergenic
968307758 3:197660514-197660536 CTGAGTGCCCAGCGTCAGCATGG - Intergenic
968490325 4:886704-886726 CTGCGTGTGGAGCGTCAGCAGGG - Intronic
968502083 4:955535-955557 CTCAGTGCGGAGCAGCCGCACGG - Intronic
973366055 4:49210500-49210522 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
973394544 4:49581951-49581973 ATCAGTGGAGAGCTGCAGCAAGG + Intergenic
973536511 4:51888182-51888204 ATGACAGAGGAGTGGCAGCAGGG + Intronic
974578191 4:63756658-63756680 ATGAGTGCAGCACAGCAGCATGG + Intergenic
976086598 4:81413166-81413188 ATGAGGCTGGAGAGGCAGCAGGG + Intergenic
976592208 4:86860310-86860332 ATGAGAGCAGAGTGTCAGCAGGG + Intergenic
979010019 4:115355483-115355505 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
981446512 4:144845605-144845627 ATTTCTGCGGGGCGGCAGCAGGG - Intergenic
1202763569 4_GL000008v2_random:132981-133003 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
989941200 5:50151785-50151807 ATGAGTGCAGTACGCCAGCATGG + Intergenic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
1000986947 5:167871208-167871230 ATGAGTGAGGACCTGGAGCATGG + Intronic
1006197504 6:32254935-32254957 GGGAGTGCGGAGGGGCAGAAAGG + Intergenic
1006415103 6:33898997-33899019 ATCAGTGCGGATGGGCAGGAGGG + Intergenic
1009778214 6:68233743-68233765 CTGAGTGCGGAGAGGCAGTAGGG - Intergenic
1012711318 6:102609776-102609798 ATGGGTGCAGGGCAGCAGCATGG - Intergenic
1018093914 6:160368129-160368151 ATGAGTGGGGAGGGGCAGGTTGG - Intronic
1018531210 6:164765312-164765334 ACCGCTGCGGAGCGGCAGCAGGG + Intergenic
1018910858 6:168100346-168100368 ATGGGTGGGGAGAGGCGGCATGG + Intergenic
1018971059 6:168529560-168529582 ATGTGTGCGGAGGGGAAGCCTGG - Intronic
1019574821 7:1732322-1732344 ATGAGAGCTGAGAGACAGCAAGG + Intronic
1020251212 7:6469988-6470010 TTGACTGCGAAGCGGCAGCATGG - Intronic
1027343898 7:77237952-77237974 ATGGCTGGGGAGTGGCAGCATGG - Intronic
1030345633 7:108430105-108430127 ATGAGGCCAGAGAGGCAGCAGGG + Intronic
1032963254 7:137065590-137065612 ATGAGTGCAGCGCACCAGCATGG - Intergenic
1034100291 7:148445206-148445228 AAGAGTGCGGGTGGGCAGCATGG - Intergenic
1034255163 7:149720781-149720803 GTGAGTGCTGAGCAGCCGCAGGG + Intronic
1034295946 7:149972578-149972600 ATGGGTGGAGAGCGGGAGCAGGG - Intergenic
1034535062 7:151721175-151721197 CTGAGTGCTGGGCGGCTGCAGGG - Intronic
1034810105 7:154124324-154124346 ATGGGTGGAGAGCGGGAGCAGGG + Intronic
1037352880 8:17981149-17981171 ATGAGTCTGGAGAGGCAGGAAGG - Intronic
1037666250 8:20972670-20972692 ATGAGTCAGGACAGGCAGCAAGG + Intergenic
1039460088 8:37736648-37736670 ACGAGTACGGAGCGCCTGCAGGG + Exonic
1047483088 8:125302989-125303011 GGGAGTGTGGAGCTGCAGCATGG - Intronic
1049042409 8:140122694-140122716 ATGAGTAGGGAGCGGCAGAGAGG + Intronic
1051839592 9:21380244-21380266 CTGAGTGCGGAAAGCCAGCAAGG + Intergenic
1053245072 9:36528078-36528100 ATAAGTGAGGAGCTGCAGAAGGG + Intergenic
1062248274 9:135581235-135581257 AGGAGTGTGGAGAGGCAGCCAGG + Intergenic
1062594822 9:137294915-137294937 AGGAGTGCGGCGGGGCAGCCAGG + Intergenic
1062635160 9:137486812-137486834 CTGAGTGGGGAGGGGCACCAGGG - Intronic
1203544324 Un_KI270743v1:117854-117876 ATCAGTGGAGAGCTGCAGCAAGG - Intergenic
1188615303 X:32150897-32150919 AAGAGTGAGGAGTAGCAGCACGG - Intronic
1191141763 X:57121826-57121848 GTGGGCGCGGGGCGGCAGCAAGG - Intergenic
1192261153 X:69506405-69506427 ATGAGTGGGGAGGGGCCGCAGGG + Intronic
1194794713 X:98197508-98197530 ATGTGTGTGGAGGGGGAGCATGG - Intergenic
1200325259 X:155231209-155231231 ATGAGTGCTGAGAGGGAGTAGGG - Intronic