ID: 1076673165

View in Genome Browser
Species Human (GRCh38)
Location 10:132134108-132134130
Sequence ATGAGTGCGGAGCGGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673165_1076673175 10 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673165_1076673168 -9 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673168 10:132134122-132134144 CGCACTCATATCCTCTGTCGTGG No data
1076673165_1076673177 25 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673165_1076673170 -2 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673170 10:132134129-132134151 ATATCCTCTGTCGTGGTTCTGGG No data
1076673165_1076673173 8 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673165_1076673176 24 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673165_1076673174 9 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673165_1076673169 -3 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673169 10:132134128-132134150 CATATCCTCTGTCGTGGTTCTGG No data
1076673165_1076673172 7 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673165 Original CRISPR ATGAGTGCGGAGCGGCAGCA AGG (reversed) Intronic