ID: 1076673166

View in Genome Browser
Species Human (GRCh38)
Location 10:132134116-132134138
Sequence CAGAGGATATGAGTGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673166_1076673172 -1 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673166_1076673177 17 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673166_1076673175 2 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673166_1076673173 0 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673166_1076673178 30 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673166_1076673170 -10 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673170 10:132134129-132134151 ATATCCTCTGTCGTGGTTCTGGG No data
1076673166_1076673174 1 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673166_1076673176 16 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673166 Original CRISPR CAGAGGATATGAGTGCGGAG CGG (reversed) Intronic
901359011 1:8679489-8679511 CAGAGAAGATCAGTGTGGAGAGG - Intronic
902039727 1:13483916-13483938 GAGAGGAGAGGAGTGGGGAGGGG + Intronic
903764395 1:25724589-25724611 CAGAGGAAGAGAGTGGGGAGAGG + Intronic
904905314 1:33893402-33893424 CAGAGGATAGGAGAGGGGAAAGG + Intronic
906333516 1:44907935-44907957 AAAAGGATATGAGTACAGAGAGG - Intronic
906652680 1:47524014-47524036 CAGATGATATGGATGCTGAGAGG + Intergenic
907770601 1:57459770-57459792 GAGAGGATATGTGGGCAGAGTGG - Intronic
910438085 1:87225992-87226014 CAGAGGAGATGACTGCTGAGTGG + Intergenic
912812667 1:112805709-112805731 CAGAGAAAATGAATGTGGAGGGG - Intergenic
914915626 1:151817487-151817509 CAGAGGAGGGGAGTGTGGAGGGG + Intronic
915270524 1:154750315-154750337 CCGAGGAAATGGGTGAGGAGGGG - Intronic
915848603 1:159296891-159296913 AAGAGGGTATGAGTGAGGATGGG - Intronic
919984605 1:202664127-202664149 CAGAGGATATGAATGTTGAGAGG + Intronic
922162957 1:223091583-223091605 CATAGGATGTGAGTGCAGAAAGG + Intergenic
922251413 1:223852236-223852258 CAGACTAAATGAGTGAGGAGGGG - Intergenic
924317308 1:242811625-242811647 CAGAGGTTAGGGGTGGGGAGGGG - Intergenic
1064573575 10:16721325-16721347 CAGGGGAGATGAGTCCAGAGAGG + Intronic
1066192648 10:33070037-33070059 CAGAGGCTATGAGGGCAGGGTGG - Intergenic
1068367510 10:56069179-56069201 CAGTGTATATGAGTCCTGAGGGG - Intergenic
1068522431 10:58092880-58092902 CAGGGGTTATGAATGGGGAGGGG + Intergenic
1070183234 10:74034772-74034794 CAAAGGATATCAGTGAGGGGTGG + Intronic
1071158478 10:82719078-82719100 TAGAGGAAATGAGTGCCCAGAGG + Intronic
1071336246 10:84602666-84602688 CAGAGGAGAGAGGTGCGGAGAGG - Intergenic
1071336275 10:84602895-84602917 CAGAGGAGAGAGGTGCGGAGAGG - Intergenic
1071405130 10:85322637-85322659 CTGGGGATCTGAGTGTGGAGTGG - Intergenic
1071462861 10:85914936-85914958 CAAAGGATATGTGGGCAGAGGGG + Intronic
1073580586 10:104662183-104662205 CAGAGTTTGTGAGTGCGGATAGG + Intronic
1075262971 10:120978858-120978880 CTGAGGGTATGTGTGCGGTGGGG + Intergenic
1076673166 10:132134116-132134138 CAGAGGATATGAGTGCGGAGCGG - Intronic
1077485662 11:2837385-2837407 CGGAGGCTGTGAGCGCGGAGCGG - Intronic
1079116370 11:17643133-17643155 CAGAGGATAAGGGAGGGGAGGGG - Intronic
1079448685 11:20580575-20580597 CACATGATAGGAGTGAGGAGTGG - Intergenic
1080745651 11:35106359-35106381 CACAGGATATGAGTCCTGGGTGG - Intergenic
1080946155 11:36977878-36977900 CAGGAGATATGAGTGTGGTGAGG + Intergenic
1082751458 11:57022725-57022747 CACAGGATAGGGGGGCGGAGTGG + Intergenic
1083307783 11:61769943-61769965 CAGAGGAGATGGGGACGGAGGGG + Intronic
1084269416 11:68021125-68021147 CAAAGGAGATGGGTGGGGAGGGG + Intronic
1095462659 12:42458823-42458845 CAGGGGTTATGTGTGTGGAGGGG + Exonic
1096757643 12:53813416-53813438 GGGATGATATGAGTGAGGAGGGG - Intergenic
1096801005 12:54110434-54110456 CAGAGGATATGAGATGGGTGGGG - Intergenic
1096820185 12:54227736-54227758 CAGAGGATTATAGTGTGGAGTGG + Intergenic
1100122984 12:91390725-91390747 CAGAGGCTATGAATGGTGAGTGG - Intergenic
1100183021 12:92106153-92106175 CATAGGATTTGACTGTGGAGAGG + Intronic
1103360822 12:120352629-120352651 CAGAGGATGTAAGTGCTTAGGGG + Intronic
1104501751 12:129293011-129293033 GAGAGGATCTGAGGGCAGAGGGG + Intronic
1105657855 13:22459656-22459678 CAGAGGGTATTAGAGCCGAGAGG - Intergenic
1106554091 13:30795459-30795481 CAGAGGACAAGAGTGTGGGGAGG - Intergenic
1107217697 13:37941223-37941245 CAGAGGATATAGGGGAGGAGAGG + Intergenic
1110933861 13:81258215-81258237 ATAAGGATATGAATGCGGAGTGG + Intergenic
1112302069 13:98239741-98239763 CGGAGGAGATGAGCGGGGAGGGG + Intronic
1112845763 13:103641304-103641326 CAGAGTATATGAAAGTGGAGAGG - Intergenic
1112883042 13:104133174-104133196 CAGAGAATAAGAGTGAGGTGAGG - Intergenic
1118883513 14:69848599-69848621 CAGAGGCTAGGGGTGTGGAGGGG + Intergenic
1119704353 14:76774664-76774686 CAGAGGCTCAGAGTGCGGCGAGG - Intronic
1122690562 14:103530219-103530241 TAGAGGATCTGCGTGCGGTGCGG - Exonic
1125172222 15:36778457-36778479 CAGAGGATAGGAATGTGGAAGGG - Intronic
1128915322 15:71554964-71554986 AGGAGGACATGAGTGGGGAGTGG - Intronic
1129424387 15:75453828-75453850 CAGGGGATTACAGTGCGGAGTGG - Intronic
1131458606 15:92602819-92602841 CAGAGGATCAGAGAGCGGGGGGG - Intergenic
1131719348 15:95150347-95150369 CAGTGGATATGTGTGTGAAGGGG + Intergenic
1131762722 15:95641867-95641889 CAGAGGAGATGCCTGGGGAGAGG + Intergenic
1136851856 16:33618535-33618557 CAGTGGATTTGAGTGAGGAGTGG + Intergenic
1139328586 16:66170389-66170411 CAGAGCATAGGAGTGCGGTCAGG - Intergenic
1141275607 16:82585131-82585153 CTGAAGATATCAGTGAGGAGTGG + Intergenic
1142427595 16:90008917-90008939 CAGAGGCTCTGAGGGCAGAGGGG + Exonic
1203113458 16_KI270728v1_random:1467020-1467042 CAGTGGATTTGAGTGAGGAGTGG + Intergenic
1142806518 17:2373908-2373930 CAGAGGATATGGGTGGAGAGGGG - Intronic
1142846555 17:2681818-2681840 CAGAGGAAAAGAGGGAGGAGGGG - Exonic
1144137166 17:12307636-12307658 CAGAGGAGAGGAGAGGGGAGGGG - Intergenic
1146744164 17:35313589-35313611 CAGTGTATATGAGTCCGGAATGG + Intergenic
1148216808 17:45837757-45837779 GAGAGAATCTGAGGGCGGAGGGG + Intergenic
1148784353 17:50138321-50138343 CAGAGCAGATGGGTGCAGAGTGG + Intronic
1153604902 18:6823217-6823239 CAGAGGATAGGAGTGGGATGGGG - Intronic
1153967469 18:10194948-10194970 CAGAGGGTATCAGTGAGGAGAGG - Intergenic
1156411997 18:36839213-36839235 CAGAGGATCAGAGAGCTGAGAGG - Intronic
1156685002 18:39633702-39633724 AAAAGGATATGACTGTGGAGTGG + Intergenic
1162340721 19:10090091-10090113 CTGAGGATAGGAGTCAGGAGTGG - Intronic
1163072868 19:14859477-14859499 CAGAGGATAGGGGTGAGGACAGG + Intergenic
1163241859 19:16068857-16068879 CAGCTGAAAAGAGTGCGGAGGGG + Intronic
1165938402 19:39403203-39403225 CTGAGGATCTGAGGGAGGAGGGG + Intergenic
1166043094 19:40214932-40214954 CAGAGGAGGTGAGTGGGGTGGGG - Intronic
1168484237 19:56747502-56747524 TAGAGGAGATGATTGGGGAGTGG - Intergenic
1168718624 19:58542809-58542831 AAGAGGGTGTGTGTGCGGAGGGG - Intergenic
925720471 2:6821787-6821809 CATTGGATATGAGAGCTGAGAGG + Intergenic
926203637 2:10819370-10819392 AAGAGGAGATGAGTGAGGTGGGG + Intronic
926528505 2:14012054-14012076 CAGAGGACATGACTTCAGAGTGG + Intergenic
929538589 2:42801525-42801547 CAGAGGATATGGGGGCTGGGAGG - Intergenic
930257248 2:49106397-49106419 TAGAGGATATGAGTGCATGGGGG + Intronic
931459001 2:62433914-62433936 TTGAGGAAATGAGTGAGGAGGGG + Intergenic
932078859 2:68692800-68692822 GAGAGGAGTTGAGTGAGGAGAGG - Intronic
932761150 2:74440053-74440075 CAGGGAATCTGTGTGCGGAGAGG + Intronic
936564491 2:113572444-113572466 CAGAGAAAATGAGTGAGCAGTGG - Intergenic
936985759 2:118310436-118310458 CAGAGGATTTGAAGGCGCAGCGG - Intergenic
938636296 2:133230307-133230329 GAGAGTATATGAGTGGAGAGAGG - Intronic
938697691 2:133849301-133849323 GAGGGGATATGAGGGAGGAGAGG + Intergenic
939444429 2:142290485-142290507 CAGAGTATCTGACTGTGGAGTGG + Intergenic
941149234 2:161893242-161893264 CATAGCACATGTGTGCGGAGGGG + Intronic
942332810 2:174845768-174845790 CAGAGCATATGGGTGGGGGGGGG + Intronic
943211037 2:184966430-184966452 CTGGGGAATTGAGTGCGGAGGGG - Intergenic
947713922 2:232330537-232330559 CAGAGGGGATGGGTGGGGAGAGG - Intronic
948720354 2:239895340-239895362 CAGAGCATATGAGTGAGGAGGGG + Intronic
1170388645 20:15848677-15848699 CAGAGGGTAAGAGGGAGGAGAGG + Intronic
1172491469 20:35341937-35341959 TAGAGGAAATGAGTTTGGAGAGG + Intronic
1174698342 20:52582698-52582720 CAGAGGAAATCAGAGCAGAGAGG - Intergenic
1176906114 21:14503587-14503609 CAGAGGATAAGAGTAAGAAGGGG + Intronic
1179423236 21:41252468-41252490 CAGAAAATATGCGTGCTGAGTGG - Intronic
1181730742 22:24844575-24844597 CAGGGGATGGGAGTGGGGAGGGG + Intronic
1181959956 22:26615939-26615961 CAGAGGATAAGAGTCTGGGGAGG + Intronic
950812325 3:15660775-15660797 CAGGGGATATGAGGGAGGAAAGG - Intergenic
953062029 3:39435257-39435279 CACAGGATCTGAGTCAGGAGAGG + Intergenic
953903497 3:46856828-46856850 CAAAGGCTTTGAGTGGGGAGTGG - Intergenic
960387024 3:117033236-117033258 CAGAAAATATCAGTGTGGAGAGG - Intronic
962609904 3:137066426-137066448 GAGAGGATCTGAGAGTGGAGGGG - Intergenic
963372037 3:144412742-144412764 CTGAGGATAGGTGTGGGGAGTGG + Intergenic
966624962 3:182005846-182005868 CAGAGGAAATGAGACTGGAGAGG + Intergenic
966738559 3:183210863-183210885 CAGAGGATGTGAATCCAGAGAGG + Intronic
969717882 4:8877245-8877267 GAGAGGAGAGGAGTGGGGAGAGG + Intergenic
973277661 4:48327031-48327053 CAGTGGATATGGGTGAGGGGTGG - Intergenic
974146439 4:57953509-57953531 CAGAGGAGAGGAGAGGGGAGGGG + Intergenic
978324865 4:107541610-107541632 CAGAGGATTTAAGGGAGGAGAGG + Intergenic
984521681 4:180809792-180809814 CAGAGGGTATGTGTGTGGTGGGG - Intergenic
986425055 5:7622998-7623020 CAGAGGAAATAAGTGGGGAGTGG + Intronic
992073909 5:73173729-73173751 CAGAGGTTATGAGGCCGCAGGGG - Exonic
994403519 5:99314446-99314468 CTGAGGATATGAGAACAGAGAGG - Intergenic
994884858 5:105547673-105547695 CAGAGGTTATGGGTGTGGACAGG + Intergenic
995251798 5:110001923-110001945 CAGGGGATGAGAGTGGGGAGTGG + Intergenic
996316266 5:122164168-122164190 TTGGGGATATGAGTGAGGAGAGG + Intronic
997627534 5:135341270-135341292 CACAGGATAGGAGAGCTGAGGGG + Intronic
997702737 5:135915407-135915429 CAGAGGATAGGAGTGTGAACAGG - Intergenic
999317833 5:150595803-150595825 GAGAGGAAATGAGGGGGGAGTGG - Intergenic
1000702509 5:164470611-164470633 CACTGCATATGAGTGCAGAGTGG + Intergenic
1001919372 5:175588510-175588532 CAGAGGATATATGGGAGGAGAGG + Intergenic
1002326294 5:178409399-178409421 CAGAGGTTAAGAGTGGTGAGAGG + Intronic
1006601501 6:35229634-35229656 CAAAGGAGATCAGTGAGGAGAGG - Intronic
1007358229 6:41335955-41335977 CAGAGGAGATGGGTGTGGTGGGG + Intronic
1007376630 6:41461350-41461372 CAGAGAAAATGTGTGGGGAGAGG + Intergenic
1007595944 6:43051334-43051356 CTGAGGAGTTGAGTGGGGAGAGG - Exonic
1009473640 6:64060378-64060400 CAGAGGATATATGTGGGGAAAGG + Intronic
1011219732 6:85041540-85041562 CATAGAATATGAGAGCAGAGGGG + Intergenic
1012323032 6:97876233-97876255 CAGAGGCTTTGTGTGGGGAGGGG - Intergenic
1013988969 6:116230809-116230831 CAGCGGATGTTAGTGCTGAGGGG + Intronic
1014114037 6:117652663-117652685 CTGAGGATATGAATGTTGAGAGG - Intergenic
1017756707 6:157535221-157535243 CAGAGTTCATGAGTGAGGAGAGG - Intronic
1018093916 6:160368137-160368159 GAGAGGGTATGAGTGGGGAGGGG - Intronic
1019217004 6:170450431-170450453 CAGAGGATGAGTGTGAGGAGAGG + Intergenic
1023361603 7:39422616-39422638 CAGAGGTTATGACTGTGGTGCGG + Intronic
1023550959 7:41369592-41369614 GAGTGGAGATGAGTGAGGAGTGG - Intergenic
1024220598 7:47283682-47283704 CAGAGGAAGTGAGTGCCTAGAGG - Exonic
1024320483 7:48062199-48062221 GAGAGGCTGTGAGTGCTGAGAGG + Intergenic
1025259050 7:57404988-57405010 CATGGGATGTGAGTCCGGAGAGG + Intergenic
1025609800 7:63068166-63068188 CATGGGATGTGAGTCCGGAGAGG - Intergenic
1026720723 7:72828474-72828496 AAGAGGAAAGGAGTGGGGAGCGG + Intergenic
1026869894 7:73843996-73844018 TAGAGGTCATGACTGCGGAGAGG + Intergenic
1030312228 7:108080390-108080412 CGGAGGCTGTGAGTGTGGAGAGG - Intronic
1031714786 7:125095567-125095589 TAGAGTATATGTGTGTGGAGGGG + Intergenic
1032477366 7:132221349-132221371 CAGAGGTTCTATGTGCGGAGAGG - Intronic
1033900793 7:146136534-146136556 CAGAGGAAATTAGTGTGGCGTGG + Intronic
1034575201 7:151990743-151990765 AACAGGAAATGAGTGTGGAGGGG - Intronic
1035316037 7:157998005-157998027 CAGAGGAGAGGAGTGCAGGGTGG + Intronic
1035950355 8:4013221-4013243 CAGAGGATAGGAGAGGGGAAAGG - Intronic
1041039840 8:53835935-53835957 GGGAGGATATGAGTGGGGACCGG - Intronic
1041140766 8:54816876-54816898 CAGTGGAAATGAGTTTGGAGTGG - Intergenic
1044347371 8:91120772-91120794 CAGAGGAACTGACTGAGGAGTGG - Intronic
1048366516 8:133743322-133743344 CTGAGGATCTGAGTGTAGAGAGG + Intergenic
1048912996 8:139153973-139153995 CACTGGACATGAGTGGGGAGGGG + Intergenic
1049493955 8:142920685-142920707 CAGAGGTAAGGTGTGCGGAGAGG + Intergenic
1049887929 9:40764-40786 CAGAGAAAATGAGTGAGCAGTGG + Intergenic
1050985469 9:12076641-12076663 GAGAGGAGAGGAGAGCGGAGGGG - Intergenic
1051764298 9:20505545-20505567 CAGAGGATAAGAATTCGAAGAGG + Intronic
1053199013 9:36140261-36140283 CAGAGGAAATCAGAGCAGAGAGG + Intronic
1054756896 9:68967978-68968000 CAGAAGAAAGGAGTGCTGAGTGG + Intronic
1054821968 9:69531633-69531655 CAGAGGCCATGAGTGCTGAAGGG - Intronic
1057852013 9:98573094-98573116 CAGAGGATAGGTGGACGGAGGGG - Intronic
1060919517 9:127409794-127409816 CAGAGCTTATGAGTTCGGGGAGG + Intergenic
1190333845 X:49251147-49251169 CAAAGGATATGATGGGGGAGGGG + Exonic
1195496102 X:105535764-105535786 CAGAGGTTAGGAGTGAGGGGAGG + Intronic
1195719661 X:107854577-107854599 CAGAGGGTATGAATCCAGAGGGG - Intronic
1201220800 Y:11768138-11768160 CAGAGGTTAGGGGTGGGGAGGGG - Intergenic
1201317930 Y:12666311-12666333 CTGAGGATATGAGTGGGGAATGG - Intergenic