ID: 1076673166

View in Genome Browser
Species Human (GRCh38)
Location 10:132134116-132134138
Sequence CAGAGGATATGAGTGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673166_1076673173 0 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673166_1076673177 17 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673166_1076673172 -1 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673166_1076673175 2 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673166_1076673174 1 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673166_1076673176 16 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673166_1076673170 -10 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673170 10:132134129-132134151 ATATCCTCTGTCGTGGTTCTGGG No data
1076673166_1076673178 30 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673166 Original CRISPR CAGAGGATATGAGTGCGGAG CGG (reversed) Intronic