ID: 1076673167

View in Genome Browser
Species Human (GRCh38)
Location 10:132134121-132134143
Sequence CACGACAGAGGATATGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673167_1076673174 -4 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673167_1076673173 -5 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673167_1076673178 25 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673167_1076673172 -6 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673167_1076673177 12 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673167_1076673176 11 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673167_1076673175 -3 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673167 Original CRISPR CACGACAGAGGATATGAGTG CGG (reversed) Intronic