ID: 1076673167

View in Genome Browser
Species Human (GRCh38)
Location 10:132134121-132134143
Sequence CACGACAGAGGATATGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673167_1076673173 -5 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673167_1076673172 -6 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673172 10:132134138-132134160 GTCGTGGTTCTGGGATGCGCTGG No data
1076673167_1076673175 -3 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673175 10:132134141-132134163 GTGGTTCTGGGATGCGCTGGGGG No data
1076673167_1076673176 11 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673167_1076673174 -4 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673174 10:132134140-132134162 CGTGGTTCTGGGATGCGCTGGGG No data
1076673167_1076673177 12 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673167_1076673178 25 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673167 Original CRISPR CACGACAGAGGATATGAGTG CGG (reversed) Intronic
902610767 1:17596005-17596027 CACGACCTGGGATATGACTGTGG - Intronic
903104065 1:21059458-21059480 CACTACAGTGGATATGAGGAAGG + Intronic
905207566 1:36351611-36351633 CAGGACACTGGGTATGAGTGAGG + Intronic
909908150 1:81224365-81224387 CATGTGTGAGGATATGAGTGGGG - Intergenic
910146588 1:84086740-84086762 AACTACAGGGGATTTGAGTGTGG - Intronic
911881102 1:103239047-103239069 CACAACTGAGGATGTGAGTGGGG + Intergenic
915848605 1:159296896-159296918 CGTGAAAGAGGGTATGAGTGAGG - Intronic
917633567 1:176914289-176914311 GAGGAGAGAGGACATGAGTGAGG + Intronic
1069590186 10:69636621-69636643 CACGACAGAGGACATGGCAGAGG + Intergenic
1076673167 10:132134121-132134143 CACGACAGAGGATATGAGTGCGG - Intronic
1077581101 11:3417872-3417894 CAGGACAGAGGGTGTGGGTGAGG + Intergenic
1084503884 11:69553395-69553417 CACGACGTAGGACATGAGGGAGG - Intergenic
1084834381 11:71792124-71792146 CAGGACAGAGGGTGTGAGTGAGG - Intronic
1088147990 11:106706763-106706785 CATGTAATAGGATATGAGTGAGG + Intronic
1088760611 11:112925655-112925677 CACAACAGAAGTTATTAGTGTGG + Intergenic
1089665306 11:120014232-120014254 CAAGAGAGAGGTGATGAGTGTGG - Intergenic
1090361783 11:126177728-126177750 CACTACAGTGGATATAGGTGGGG - Intergenic
1090889208 11:130907999-130908021 CCCCACAGAGGAGCTGAGTGAGG - Exonic
1091103907 11:132900563-132900585 AACAATAGAAGATATGAGTGAGG - Intronic
1092408700 12:8238340-8238362 CAGGACAGAGGGTGTGAGTGAGG + Intergenic
1096118262 12:49069147-49069169 AAGGACAGAGGATGTGAATGTGG - Intronic
1101534488 12:105604907-105604929 CAGAACAGAGGATATGCATGGGG - Intergenic
1102554942 12:113720668-113720690 CAAGAGAGAGGAGAGGAGTGAGG + Intergenic
1104159935 12:126168424-126168446 CATGACAGAGGCTATCAGGGTGG - Intergenic
1104362233 12:128144623-128144645 AAGGACAGAGGACCTGAGTGGGG + Intergenic
1107388675 13:39941041-39941063 TACCACAGAGGTTATGAGTCTGG - Intergenic
1110731172 13:78880196-78880218 TACCAAAGAGGATATGAGTTAGG - Intergenic
1114733188 14:25016471-25016493 CACTACAAAGGATTTGGGTGGGG - Intronic
1116509919 14:45732082-45732104 TATGGCAGAGGGTATGAGTGGGG - Intergenic
1117579641 14:57139304-57139326 CAAGAAAGAGAATGTGAGTGGGG + Intergenic
1118192874 14:63596009-63596031 CAGGACAGAGGATATCAGGAGGG - Intergenic
1118328758 14:64799979-64800001 CACCACTGAGGATATCAATGAGG + Intronic
1121091712 14:91187543-91187565 CAGCCCAGAGGATACGAGTGGGG - Intronic
1121336635 14:93081798-93081820 CAGGACAGAGGATAAAGGTGGGG + Intronic
1132719302 16:1308128-1308150 AATGAGAGAGGAAATGAGTGAGG + Intergenic
1135903827 16:26492014-26492036 CAAGACTGGGGATATGACTGAGG - Intergenic
1137233678 16:46594450-46594472 CACTAAAGAGGATATAAGGGTGG + Intronic
1140105457 16:71955690-71955712 CATGACAGAGGAGAGGATTGTGG - Intronic
1142741570 17:1934744-1934766 CACCAGAGAGGATGTGTGTGAGG - Exonic
1151744664 17:76005435-76005457 CTCGAGAAAGGATCTGAGTGTGG - Exonic
1154464486 18:14630688-14630710 CCCCACAGAGGAGCTGAGTGAGG - Intergenic
1157997783 18:52580091-52580113 CAGCACAGAGGCTAAGAGTGCGG - Intronic
1162939899 19:14002843-14002865 CATGACAGAGGAGAAGGGTGAGG + Intronic
1164440716 19:28276901-28276923 CAATACAGTGGATGTGAGTGGGG - Intergenic
925263132 2:2545402-2545424 CACATCTGAAGATATGAGTGAGG - Intergenic
929553236 2:42907303-42907325 CACTACAGAGGAGGGGAGTGAGG + Intergenic
930974124 2:57433694-57433716 CAAGACAGAGCATATGTTTGAGG - Intergenic
931132884 2:59358504-59358526 CATGACAGGGGGTATAAGTGGGG - Intergenic
934153527 2:89172970-89172992 AAGGACAGAGGAGATGAGGGAGG - Intergenic
934213709 2:90008962-90008984 AAGGACAGAGGAGATGAGGGAGG + Intergenic
935916378 2:107955493-107955515 CACTACAGAGGATGTGATTTAGG + Intergenic
936780607 2:116028555-116028577 TTTGACAGAGGATATCAGTGAGG + Intergenic
938691986 2:133800273-133800295 CACCACAGAGGATATTAGGAAGG + Intergenic
938949451 2:136243551-136243573 CAAGACAGAGGCTGCGAGTGGGG + Intergenic
939731665 2:145792631-145792653 CATGACAGATAATTTGAGTGAGG - Intergenic
940427849 2:153551282-153551304 CATGACAGAGGATCTGGATGGGG + Intergenic
942245576 2:174004809-174004831 CAAGATAGAAGATGTGAGTGTGG - Intergenic
942654839 2:178204527-178204549 CAAGAGAGAGGAAAGGAGTGAGG - Intronic
944400045 2:199315496-199315518 CACCACAGATGAAAAGAGTGGGG + Intronic
948720350 2:239895335-239895357 GACCACAGAGCATATGAGTGAGG + Intronic
1171056221 20:21909482-21909504 CAGGACAGAGGATATGAGTGGGG - Intergenic
1173534081 20:43795481-43795503 CACAAAAGAGGAGAAGAGTGAGG + Intergenic
1173708361 20:45132015-45132037 CACAACAGAGGATATCTTTGAGG - Intergenic
1175371057 20:58492394-58492416 CACAAAAGAGGAAATGAGAGTGG + Intronic
1176810051 21:13527701-13527723 CCCAACAGAGGAGCTGAGTGAGG + Intergenic
1181628209 22:24135561-24135583 CAGGACAGAGGAAATGGGGGAGG - Intronic
1183121894 22:35736505-35736527 AACAACAGTGGACATGAGTGTGG - Intergenic
1184311053 22:43643113-43643135 CACGAAAGAGCATTTGATTGAGG + Intronic
953740195 3:45531806-45531828 CACAACAAATGATATGTGTGAGG - Intronic
957053971 3:75430505-75430527 CAGGACAGAGGGTGTGGGTGAGG + Intergenic
961300871 3:125921210-125921232 CAGGACAGAGGGTGTGGGTGAGG - Intergenic
967066418 3:185921140-185921162 TATGACAGAGGATATGATCGGGG - Exonic
968996774 4:3950812-3950834 CAGGACAGAGGGTGTGGGTGCGG + Intergenic
969817188 4:9695429-9695451 CAGGACAGAGGGTGTGGGTGAGG - Intergenic
979545885 4:121939607-121939629 CACCACAGAGGAGCTGAGGGTGG - Intronic
981117155 4:141005054-141005076 CAGGAGACAGGATATGAGGGAGG + Intronic
991150904 5:63368365-63368387 CACGACAAAGGATAGGAAAGAGG + Intergenic
991201055 5:63993301-63993323 TACTACAGAGGATATTATTGTGG - Intergenic
992299078 5:75359181-75359203 TACCACAGAGGCTATGATTGAGG + Exonic
996676373 5:126179600-126179622 CACACCAGCGGATATTAGTGTGG - Intergenic
996776835 5:127141856-127141878 CCAGAAAGAGGATGTGAGTGGGG + Intergenic
997936236 5:138113608-138113630 CATGACAGAGGCTTTGAATGTGG + Intergenic
999764470 5:154728586-154728608 CCAGACACAGTATATGAGTGAGG + Intronic
1001196783 5:169680124-169680146 TACCAGAGAGGTTATGAGTGTGG + Intronic
1002284901 5:178155624-178155646 CACAACCGAGGCTCTGAGTGAGG - Intergenic
1007414131 6:41682356-41682378 CAGGACAGAGGGTGTGAGTGGGG - Intergenic
1009286226 6:61821425-61821447 GTGGACACAGGATATGAGTGAGG + Intronic
1010507749 6:76681193-76681215 CATGACAGATCATATGAGGGTGG + Intergenic
1013649234 6:112177158-112177180 CATGAGAGAGTATGTGAGTGAGG + Intronic
1020756012 7:12203725-12203747 AATGACTGAGGAAATGAGTGGGG - Intergenic
1028486885 7:91369027-91369049 CACCAAAGAGGATATAAGTATGG - Intergenic
1034312102 7:150097850-150097872 GAGGACAGAGCATATGAGGGTGG - Intergenic
1034794753 7:154002808-154002830 GAGGACAGAGCATATGAGGGTGG + Intronic
1035920619 8:3671888-3671910 CAGGACAGAGGAAATGAGGGTGG - Intronic
1036826266 8:11978371-11978393 GACGTCAGGGGATATCAGTGGGG + Intergenic
1036972826 8:13374440-13374462 CAAGAGAGTGTATATGAGTGAGG + Intronic
1038663209 8:29514950-29514972 CAAGAAACAGAATATGAGTGTGG - Intergenic
1039817336 8:41106092-41106114 CACGTCAGAGCAGATGAATGTGG + Intergenic
1040681325 8:49813248-49813270 CATGAAAGAGGATTAGAGTGAGG + Intergenic
1045520119 8:102896133-102896155 CAAGAGAGAGGATATGAGTGGGG + Intronic
1048829859 8:138465491-138465513 CACGAGAGAGGATTTTAGAGAGG - Intronic
1055747747 9:79468971-79468993 TACTACAGATGAGATGAGTGAGG + Intergenic
1057589639 9:96361222-96361244 CATAACAGTGCATATGAGTGAGG - Intronic
1057702072 9:97370533-97370555 CAGGTCAGAGGACATGAGTCTGG + Intronic
1058109321 9:101014859-101014881 CACCACAGATGATATTTGTGAGG + Intergenic
1058780734 9:108331946-108331968 CACAACAGGGGATAAGATTGGGG + Intergenic
1060307200 9:122424557-122424579 CAACACAGAGGATATCACTGAGG - Intergenic
1060439187 9:123622591-123622613 CACTTCAGAGGATATTAGTAAGG + Intronic
1060850367 9:126869691-126869713 CACGGCAGAGGCTGTGTGTGAGG + Intronic
1062328506 9:136024441-136024463 GAGGACAGAGGGTATGTGTGAGG + Intronic
1203779116 EBV:91197-91219 CATGACAGAGGATTTGAATCTGG - Intergenic
1188988082 X:36785769-36785791 CTGGACAGAGGATGTGAATGTGG + Intergenic
1192599967 X:72451835-72451857 AAAGACAGAGGATACGAATGAGG + Intronic
1194363671 X:92986907-92986929 CACTAAAGTGGATTTGAGTGTGG - Intergenic
1194599139 X:95899072-95899094 CACAACAGAGAATAAGAGTCAGG + Intergenic
1194615803 X:96102438-96102460 CATGGTAGAAGATATGAGTGTGG + Intergenic
1200671905 Y:6103162-6103184 CACTAAAGTGGATTTGAGTGTGG - Intergenic