ID: 1076673171

View in Genome Browser
Species Human (GRCh38)
Location 10:132134133-132134155
Sequence GCATCCCAGAACCACGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673171_1076673181 23 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673181 10:132134179-132134201 ACCCTCCAGCTGGTCCTTCTGGG No data
1076673171_1076673176 -1 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673171_1076673178 13 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673171_1076673180 22 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673180 10:132134178-132134200 GACCCTCCAGCTGGTCCTTCTGG No data
1076673171_1076673177 0 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673171 Original CRISPR GCATCCCAGAACCACGACAG AGG (reversed) Intronic
900790399 1:4676080-4676102 GCATCCAGGAACCAGGAAAGAGG - Intronic
902740772 1:18436540-18436562 GCATCCCAGAGTCATGCCAGGGG + Intergenic
904774788 1:32900144-32900166 GCATCCCAGGACCAAGACTTTGG + Intronic
911998993 1:104806695-104806717 GGATCCCAGAACCAAGAAACTGG + Intergenic
920388039 1:205581673-205581695 CCATCCCACAGCCAAGACAGTGG - Intronic
1063015228 10:2070481-2070503 CCATCCCAGATCCAAGTCAGTGG - Intergenic
1064822296 10:19350832-19350854 GCATCCCAGGACCACCTCTGTGG - Intronic
1067083542 10:43226623-43226645 GCAGCCCAGAACCCACACAGTGG + Intronic
1071283408 10:84123621-84123643 GAATCCCAGAACTAAGAGAGAGG - Intergenic
1073991319 10:109265273-109265295 GCATCCCAGCACAACAACATGGG + Intergenic
1075929919 10:126287436-126287458 TCACCCCTGATCCACGACAGAGG + Intronic
1076673171 10:132134133-132134155 GCATCCCAGAACCACGACAGAGG - Intronic
1077139868 11:1019565-1019587 GGATCCCAGAAGCAGGGCAGGGG - Intronic
1078348494 11:10572981-10573003 GCATTCCAGAACCAAGTCAGAGG - Intronic
1084524065 11:69685000-69685022 GCATCCCAGAGGCAGGACGGTGG + Intergenic
1087261962 11:96021912-96021934 GCAACCCAGATCCAAGACTGTGG + Intronic
1087636022 11:100702370-100702392 GCATCCCAAAACAATTACAGTGG + Intronic
1091122593 11:133068512-133068534 GCATACCAGAACCTAAACAGGGG - Intronic
1095106922 12:38245143-38245165 GTATCCCAGATCCAAGAGAGAGG + Intergenic
1096824286 12:54262857-54262879 GAATCCCAATACCATGACAGAGG + Intronic
1100848376 12:98683556-98683578 GCATGCCTGAACCAACACAGAGG - Intronic
1107767553 13:43753508-43753530 GCACCCCAGAACCTTGCCAGAGG + Intronic
1108243121 13:48487502-48487524 GCCTCCCAACACCACCACAGTGG + Intergenic
1113780314 13:112972976-112972998 GCTTCCCAGGACCACCACACAGG + Intronic
1124219508 15:27837291-27837313 GCCTACCAGAAGCAAGACAGTGG - Intronic
1124919443 15:34011635-34011657 GCATCCCACAACCAAGAAAATGG + Intronic
1125466485 15:39958165-39958187 ACATCCCAGAAACAAGGCAGTGG - Intronic
1131268721 15:90934003-90934025 GGTTCCCAGGACCAGGACAGAGG + Intronic
1132181030 15:99752994-99753016 GCATCCCAGGGGCACCACAGAGG - Intergenic
1133201290 16:4206264-4206286 GCATTGCAGAACCAGGACTGAGG - Intronic
1134118345 16:11566233-11566255 GCATCCCAGCACCTAGAAAGAGG + Intronic
1139737570 16:69005148-69005170 GCATCCCAGGATCAACACAGTGG + Intronic
1142427671 16:90009309-90009331 GCATCCCAGTACCAGCACCGGGG - Exonic
1142592014 17:1010384-1010406 GCATCCCAGAACCAAGGAGGAGG - Intronic
1148765959 17:50038322-50038344 CCATCCCAGAACCATGGAAGGGG - Intergenic
1151271612 17:73000664-73000686 GCAACCCAGAACCCTGACTGAGG + Intronic
1153959319 18:10127360-10127382 GAATCCCAAAACCAGGGCAGTGG - Intergenic
1161800508 19:6414876-6414898 GCTCCCCAGCATCACGACAGCGG + Intronic
1163322529 19:16582981-16583003 GCATCCCAGAAACAGGGCAAGGG - Intronic
925331550 2:3062684-3062706 TTCTCCCAGAACCACCACAGGGG + Intergenic
926060082 2:9799800-9799822 GCATCCCAGCACCTCTAGAGGGG - Intergenic
926464468 2:13169831-13169853 GCTTCCCAGAACCTCTACAGGGG + Intergenic
926772976 2:16394320-16394342 GCTTCCCAGAACCCAGAGAGGGG - Intergenic
928032669 2:27795056-27795078 TCAACCAAGAACCATGACAGAGG + Intronic
929264803 2:39905773-39905795 GCATCCCAGTACAAGGTCAGCGG + Intergenic
930008136 2:46914416-46914438 TCATTCCAGGACCATGACAGGGG - Intronic
940012912 2:149073501-149073523 GCTTCCCAGCATCACGGCAGTGG - Intronic
946531601 2:220576570-220576592 CCAGCCCAGAACCACCACAGGGG + Intergenic
1169118248 20:3081139-3081161 GGAGCCCAGAACCAGGTCAGGGG + Intergenic
1170781161 20:19426826-19426848 GAATACCTGAACCACAACAGTGG + Intronic
1171384568 20:24761568-24761590 GCATCCCACAGCCGCAACAGTGG + Intergenic
1174059356 20:47821696-47821718 GCTTCCCTGAGCCAAGACAGTGG + Intergenic
1174674618 20:52341385-52341407 GCATCACAGAACCATGTCTGCGG + Intergenic
1176953594 21:15073938-15073960 GCTTCCCAGCACCACTACACTGG + Intergenic
1179592799 21:42421314-42421336 GAAGCCCAGAACCACAACATAGG - Intronic
1179998060 21:44983000-44983022 GCGTCTCAGAGCAACGACAGTGG - Intergenic
1182517735 22:30868572-30868594 GCAGCCCAGAAGGAAGACAGTGG - Intronic
1184468064 22:44680513-44680535 GCATCCCAGAGCCGCAGCAGTGG + Intronic
950040243 3:9915412-9915434 GCCGCCCAGAGCCACGGCAGCGG - Exonic
950098467 3:10343561-10343583 CCCTCCCAGAACCTGGACAGTGG - Intronic
965850662 3:173018956-173018978 GCATCCCAGAACTTAGACTGTGG - Intronic
966852420 3:184172165-184172187 GCATCCCAGAGCAAGGACACAGG + Exonic
976022674 4:80648525-80648547 TTGTCCCAGAACCACGAAAGAGG - Intronic
985145605 4:186891450-186891472 GCATCACAGCACCACCACACTGG - Intergenic
985658483 5:1144037-1144059 GCAGCCCAGAACCAAGAAATAGG + Intergenic
987293138 5:16526783-16526805 GCATCACAGAACCACCACGGGGG - Intronic
989588729 5:43094009-43094031 GCATCCAGGAACCTAGACAGAGG + Intronic
992528776 5:77636719-77636741 GCAGCCCAGGATCTCGACAGGGG + Intronic
1001696923 5:173677279-173677301 GCATGCCAGAACCAAGACCTGGG - Intergenic
1002619213 5:180475062-180475084 GGATCCCAGAGCCAGCACAGTGG + Intergenic
1003946963 6:11084726-11084748 GAAAGCCAGAACCACCACAGGGG - Intergenic
1004305316 6:14496680-14496702 GCAATCCAGAACCAGCACAGAGG - Intergenic
1004744504 6:18496647-18496669 CCTTCCCAGCACCACAACAGAGG - Intergenic
1005812577 6:29528741-29528763 GCATCACACAGCCAGGACAGGGG + Intergenic
1007211216 6:40194675-40194697 TCATCACAGAACCACCACATTGG + Intergenic
1007597139 6:43058283-43058305 GCATCAGAGAACCAAGGCAGAGG + Intronic
1007746633 6:44047213-44047235 GCATCCCAGAACTGGGAGAGGGG - Intergenic
1014420533 6:121239096-121239118 CCATCCCAGAACTACTCCAGTGG - Exonic
1024864614 7:53890808-53890830 GTATCCTAGAACCACTACCGAGG - Intergenic
1025235546 7:57232287-57232309 GCTTCCCTGAGCCAAGACAGTGG - Intergenic
1027402759 7:77825291-77825313 GTATCCCAGAAACAAGACAAAGG + Intronic
1037663223 8:20944510-20944532 ACTCCCCAGAACCAGGACAGTGG - Intergenic
1041956958 8:63566560-63566582 GAATCCCTGAAGCAGGACAGAGG - Intergenic
1042088199 8:65131626-65131648 GAATCCCAGAACTAAGAGAGAGG - Intergenic
1043271088 8:78334453-78334475 GCCTCCCAGCACCACCACACTGG + Intergenic
1050278724 9:4028019-4028041 GCAACCCGGATCCACTACAGCGG + Intronic
1056621922 9:88221734-88221756 CCATGCCAGACCCACTACAGAGG - Intergenic
1057266338 9:93620313-93620335 GCATCCCAGGACACAGACAGAGG - Intronic
1061241687 9:129378281-129378303 ACCTCCCAGAACCACCTCAGAGG - Intergenic
1062626398 9:137444595-137444617 TCATTCCAGAACCACCACTGGGG + Intergenic
1197082900 X:122440583-122440605 GCAAACCAGTACCACCACAGTGG - Intergenic
1197297775 X:124739994-124740016 GCCTCCCAGAGCCATGACAAAGG + Intronic