ID: 1076673171

View in Genome Browser
Species Human (GRCh38)
Location 10:132134133-132134155
Sequence GCATCCCAGAACCACGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673171_1076673178 13 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673171_1076673181 23 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673181 10:132134179-132134201 ACCCTCCAGCTGGTCCTTCTGGG No data
1076673171_1076673177 0 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673171_1076673180 22 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673180 10:132134178-132134200 GACCCTCCAGCTGGTCCTTCTGG No data
1076673171_1076673176 -1 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673171 Original CRISPR GCATCCCAGAACCACGACAG AGG (reversed) Intronic