ID: 1076673173

View in Genome Browser
Species Human (GRCh38)
Location 10:132134139-132134161
Sequence TCGTGGTTCTGGGATGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673162_1076673173 18 Left 1076673162 10:132134098-132134120 CCACCCGCTTCCTTGCTGCCGCT No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673163_1076673173 15 Left 1076673163 10:132134101-132134123 CCCGCTTCCTTGCTGCCGCTCCG No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673161_1076673173 30 Left 1076673161 10:132134086-132134108 CCGGGCTGAGCTCCACCCGCTTC No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673167_1076673173 -5 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673165_1076673173 8 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673164_1076673173 14 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data
1076673166_1076673173 0 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673173 10:132134139-132134161 TCGTGGTTCTGGGATGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673173 Original CRISPR TCGTGGTTCTGGGATGCGCT GGG Intronic