ID: 1076673176

View in Genome Browser
Species Human (GRCh38)
Location 10:132134155-132134177
Sequence CGCTGGGGGATCTGAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673171_1076673176 -1 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673165_1076673176 24 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673164_1076673176 30 Left 1076673164 10:132134102-132134124 CCGCTTCCTTGCTGCCGCTCCGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673166_1076673176 16 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data
1076673167_1076673176 11 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG 0: 1
1: 1
2: 1
3: 6
4: 108
Right 1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673176 Original CRISPR CGCTGGGGGATCTGAAGTCC AGG Intronic
No off target data available for this crispr