ID: 1076673177

View in Genome Browser
Species Human (GRCh38)
Location 10:132134156-132134178
Sequence GCTGGGGGATCTGAAGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673166_1076673177 17 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673171_1076673177 0 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673165_1076673177 25 Left 1076673165 10:132134108-132134130 CCTTGCTGCCGCTCCGCACTCAT No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data
1076673167_1076673177 12 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673177 10:132134156-132134178 GCTGGGGGATCTGAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673177 Original CRISPR GCTGGGGGATCTGAAGTCCA GGG Intronic