ID: 1076673178

View in Genome Browser
Species Human (GRCh38)
Location 10:132134169-132134191
Sequence AAGTCCAGGGACCCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673167_1076673178 25 Left 1076673167 10:132134121-132134143 CCGCACTCATATCCTCTGTCGTG No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673166_1076673178 30 Left 1076673166 10:132134116-132134138 CCGCTCCGCACTCATATCCTCTG No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data
1076673171_1076673178 13 Left 1076673171 10:132134133-132134155 CCTCTGTCGTGGTTCTGGGATGC No data
Right 1076673178 10:132134169-132134191 AAGTCCAGGGACCCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673178 Original CRISPR AAGTCCAGGGACCCTCCAGC TGG Intronic