ID: 1076673382

View in Genome Browser
Species Human (GRCh38)
Location 10:132135349-132135371
Sequence GTTAGTCAACCAGCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673382_1076673391 23 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673382_1076673386 -2 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673386 10:132135370-132135392 ACCCCTGCTCTGCGTTAGTGGGG No data
1076673382_1076673384 -4 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673384 10:132135368-132135390 TAACCCCTGCTCTGCGTTAGTGG No data
1076673382_1076673388 -1 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673388 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
1076673382_1076673385 -3 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673385 10:132135369-132135391 AACCCCTGCTCTGCGTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673382 Original CRISPR GTTAGTCAACCAGCCCTTGA GGG (reversed) Intronic