ID: 1076673383

View in Genome Browser
Species Human (GRCh38)
Location 10:132135350-132135372
Sequence GGTTAGTCAACCAGCCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673383_1076673386 -3 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673386 10:132135370-132135392 ACCCCTGCTCTGCGTTAGTGGGG No data
1076673383_1076673391 22 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673383_1076673385 -4 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673385 10:132135369-132135391 AACCCCTGCTCTGCGTTAGTGGG No data
1076673383_1076673388 -2 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673388 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
1076673383_1076673394 30 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
1076673383_1076673384 -5 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673384 10:132135368-132135390 TAACCCCTGCTCTGCGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673383 Original CRISPR GGTTAGTCAACCAGCCCTTG AGG (reversed) Intronic