ID: 1076673384

View in Genome Browser
Species Human (GRCh38)
Location 10:132135368-132135390
Sequence TAACCCCTGCTCTGCGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673382_1076673384 -4 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673384 10:132135368-132135390 TAACCCCTGCTCTGCGTTAGTGG No data
1076673381_1076673384 -3 Left 1076673381 10:132135348-132135370 CCCCTCAAGGGCTGGTTGACTAA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1076673384 10:132135368-132135390 TAACCCCTGCTCTGCGTTAGTGG No data
1076673383_1076673384 -5 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673384 10:132135368-132135390 TAACCCCTGCTCTGCGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673384 Original CRISPR TAACCCCTGCTCTGCGTTAG TGG Intronic