ID: 1076673387

View in Genome Browser
Species Human (GRCh38)
Location 10:132135371-132135393
Sequence CCCCCACTAACGCAGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673387_1076673391 1 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673387_1076673394 9 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
1076673387_1076673395 10 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673395 10:132135404-132135426 CTCTGTTCTGCAGGTGATCTGGG No data
1076673387_1076673396 24 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673387 Original CRISPR CCCCCACTAACGCAGAGCAG GGG (reversed) Intronic