ID: 1076673391

View in Genome Browser
Species Human (GRCh38)
Location 10:132135395-132135417
Sequence AGAAGCCGCCTCTGTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673389_1076673391 0 Left 1076673389 10:132135372-132135394 CCCTGCTCTGCGTTAGTGGGGGC No data
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673381_1076673391 24 Left 1076673381 10:132135348-132135370 CCCCTCAAGGGCTGGTTGACTAA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673383_1076673391 22 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673390_1076673391 -1 Left 1076673390 10:132135373-132135395 CCTGCTCTGCGTTAGTGGGGGCA No data
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673382_1076673391 23 Left 1076673382 10:132135349-132135371 CCCTCAAGGGCTGGTTGACTAAC 0: 1
1: 1
2: 0
3: 4
4: 51
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data
1076673387_1076673391 1 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673391 10:132135395-132135417 AGAAGCCGCCTCTGTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673391 Original CRISPR AGAAGCCGCCTCTGTTCTGC AGG Intronic