ID: 1076673394

View in Genome Browser
Species Human (GRCh38)
Location 10:132135403-132135425
Sequence CCTCTGTTCTGCAGGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673390_1076673394 7 Left 1076673390 10:132135373-132135395 CCTGCTCTGCGTTAGTGGGGGCA No data
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
1076673383_1076673394 30 Left 1076673383 10:132135350-132135372 CCTCAAGGGCTGGTTGACTAACC 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
1076673389_1076673394 8 Left 1076673389 10:132135372-132135394 CCCTGCTCTGCGTTAGTGGGGGC No data
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
1076673387_1076673394 9 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673394 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673394 Original CRISPR CCTCTGTTCTGCAGGTGATC TGG Intronic