ID: 1076673395

View in Genome Browser
Species Human (GRCh38)
Location 10:132135404-132135426
Sequence CTCTGTTCTGCAGGTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673387_1076673395 10 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673395 10:132135404-132135426 CTCTGTTCTGCAGGTGATCTGGG No data
1076673389_1076673395 9 Left 1076673389 10:132135372-132135394 CCCTGCTCTGCGTTAGTGGGGGC No data
Right 1076673395 10:132135404-132135426 CTCTGTTCTGCAGGTGATCTGGG No data
1076673390_1076673395 8 Left 1076673390 10:132135373-132135395 CCTGCTCTGCGTTAGTGGGGGCA No data
Right 1076673395 10:132135404-132135426 CTCTGTTCTGCAGGTGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673395 Original CRISPR CTCTGTTCTGCAGGTGATCT GGG Intronic