ID: 1076673396

View in Genome Browser
Species Human (GRCh38)
Location 10:132135418-132135440
Sequence TGATCTGGGATGTGCAGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076673389_1076673396 23 Left 1076673389 10:132135372-132135394 CCCTGCTCTGCGTTAGTGGGGGC No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data
1076673393_1076673396 -8 Left 1076673393 10:132135403-132135425 CCTCTGTTCTGCAGGTGATCTGG No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data
1076673390_1076673396 22 Left 1076673390 10:132135373-132135395 CCTGCTCTGCGTTAGTGGGGGCA No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data
1076673392_1076673396 -5 Left 1076673392 10:132135400-132135422 CCGCCTCTGTTCTGCAGGTGATC No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data
1076673387_1076673396 24 Left 1076673387 10:132135371-132135393 CCCCTGCTCTGCGTTAGTGGGGG No data
Right 1076673396 10:132135418-132135440 TGATCTGGGATGTGCAGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076673396 Original CRISPR TGATCTGGGATGTGCAGACG CGG Intronic