ID: 1076674173

View in Genome Browser
Species Human (GRCh38)
Location 10:132139778-132139800
Sequence CCTTCCAGCAAAACTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076674173_1076674183 25 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674183 10:132139826-132139848 CCTGGAGGCCACTGTGGCCACGG No data
1076674173_1076674179 7 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674179 10:132139808-132139830 AGAAGAACTGGGAGGAGACCTGG No data
1076674173_1076674176 -5 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674176 10:132139796-132139818 GAAGGTTCTGGCAGAAGAACTGG No data
1076674173_1076674178 -1 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674178 10:132139800-132139822 GTTCTGGCAGAAGAACTGGGAGG No data
1076674173_1076674181 19 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674181 10:132139820-132139842 AGGAGACCTGGAGGCCACTGTGG No data
1076674173_1076674180 10 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674180 10:132139811-132139833 AGAACTGGGAGGAGACCTGGAGG No data
1076674173_1076674177 -4 Left 1076674173 10:132139778-132139800 CCTGAGGGAGTTTTGCTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1076674177 10:132139797-132139819 AAGGTTCTGGCAGAAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076674173 Original CRISPR CCTTCCAGCAAAACTCCCTC AGG (reversed) Intronic
900359252 1:2280050-2280072 CCTTCCACCTGAACCCCCTCTGG + Intronic
900682442 1:3924433-3924455 CTCTCCAGCAAAAAGCCCTCAGG - Intergenic
901240548 1:7690591-7690613 TCTTTCAGCAAAACACCTTCTGG + Intronic
903915635 1:26762260-26762282 CCTACCAGCAGAACTCCATGGGG + Exonic
905147275 1:35896747-35896769 CCCTTCAGCCTAACTCCCTCAGG - Intronic
906206735 1:43991221-43991243 CCTTCCACCACAACACACTCAGG - Intergenic
906246296 1:44276812-44276834 CCTTTCATCAAACCTCCCTGAGG + Intronic
909552714 1:76917025-76917047 CCTCCTAGAATAACTCCCTCAGG + Intronic
913545447 1:119863495-119863517 CTCTCCAGCGAGACTCCCTCTGG - Intergenic
917103443 1:171468819-171468841 GCTTCAAGCAATTCTCCCTCAGG - Intergenic
918590115 1:186231656-186231678 CCTTCCAGGAAAACACTTTCTGG + Intergenic
924881037 1:248163487-248163509 CCGTCTAGCAAAACTGACTCTGG - Intergenic
1064927931 10:20590622-20590644 CTTTCCAGCAAATGTCCCTTGGG - Intergenic
1066153379 10:32649151-32649173 CCTCCCACCACAACTCCCACAGG - Intronic
1074004279 10:109403906-109403928 CCTTCCAGGACAAATCTCTCAGG - Intergenic
1075196639 10:120365202-120365224 CCATCCAGAAAATCTCTCTCAGG + Intergenic
1075801102 10:125153789-125153811 CCTTCCAGAGAAACTTCCTCAGG + Intronic
1076106908 10:127830864-127830886 CATTCCAGCAAAGCTGCCTCCGG - Intergenic
1076674173 10:132139778-132139800 CCTTCCAGCAAAACTCCCTCAGG - Intronic
1080606855 11:33870596-33870618 CCTCCCAGCCACCCTCCCTCTGG - Intronic
1082990956 11:59206813-59206835 CCTCCCATCAGAGCTCCCTCTGG - Exonic
1084593648 11:70104767-70104789 GCTTCCATCCAAAGTCCCTCTGG - Intronic
1085974176 11:81632689-81632711 CCTGCCAGAAAGTCTCCCTCTGG - Intergenic
1088796474 11:113270108-113270130 CCTGCCAGCAAAAGCCCCTGCGG - Intronic
1089100952 11:115961977-115961999 CCACCCAGCAAAGTTCCCTCTGG + Intergenic
1089973987 11:122716814-122716836 CCTTCCAGCAAAGCTTTCTGGGG - Intronic
1090900931 11:131030494-131030516 CCTTTCAGCAACACTTCCTTGGG + Intergenic
1094139345 12:27164650-27164672 CCTTCCATCTTATCTCCCTCAGG + Intergenic
1095322836 12:40850426-40850448 CCTTTTACCAAAACTCCTTCTGG - Intronic
1099060163 12:77897936-77897958 CCTCCCAGCTAAACTCACGCTGG + Intronic
1100613119 12:96208734-96208756 AGTCCCTGCAAAACTCCCTCTGG - Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1102690065 12:114753443-114753465 CCCCCCAGCAAAAGTCCTTCTGG - Intergenic
1103660109 12:122507735-122507757 GTTTCCAGCGAAACTCCATCTGG - Intronic
1107396684 13:40025292-40025314 CCTCCCAGCATCACTCCCTGGGG - Intergenic
1108071427 13:46633215-46633237 CCTTCCAGAAATACTTCCTTGGG - Intronic
1109431623 13:62243663-62243685 GTTTTCATCAAAACTCCCTCAGG + Intergenic
1109443290 13:62401544-62401566 CCTTCCACCACAGCTCCCACTGG + Intergenic
1115786280 14:36829364-36829386 CCTTCCCGCAAGGCTTCCTCAGG + Intronic
1116352537 14:43883122-43883144 CCTTCCAACTAAAATCCCACAGG - Intergenic
1118936019 14:70289203-70289225 CCTCCCAGAGAAGCTCCCTCTGG + Intergenic
1120640483 14:87005354-87005376 GCCTACAGCAAAACTCCTTCTGG - Intergenic
1121210856 14:92207221-92207243 CCCTCCAGCCAAACTCCCTCAGG - Intergenic
1123400151 15:19976208-19976230 CCTTTTAGCAAAACTTCTTCAGG - Intergenic
1123875774 15:24622318-24622340 CATTCCAGCAACAAACCCTCTGG + Intergenic
1124150458 15:27173062-27173084 CCTTCCTGCAAACTTCACTCTGG + Intronic
1125496229 15:40196986-40197008 CCTTCCATGAAAACTCCTTGGGG + Intronic
1127127474 15:55825939-55825961 CCTTCCATCATACCTCACTCAGG - Intergenic
1127250697 15:57234046-57234068 GCTTCCAGCAGCATTCCCTCTGG - Exonic
1128366630 15:67008241-67008263 CCCTCTTGCAGAACTCCCTCAGG + Intergenic
1130102092 15:80901981-80902003 CCCTCCAGCTTAAGTCCCTCTGG + Intronic
1130311952 15:82764019-82764041 CCTTACAGCAAAACTCCTGATGG - Intronic
1131569803 15:93523402-93523424 CCTTCCAGAAAAACTAACTAGGG - Intergenic
1135163298 16:20116422-20116444 CCTTCCAGCAAAGCTGTCTGAGG - Intergenic
1136058673 16:27709700-27709722 TCTGCCAGCACCACTCCCTCAGG - Intronic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271939 16:29153661-29153683 CTTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271949 16:29153695-29153717 CTTTCCAGCCATAGTCCCTCCGG + Intergenic
1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136617343 16:31406569-31406591 CCTTCCAGCATATCCCCCACAGG - Intronic
1137769935 16:51008144-51008166 CCTTCCATCCAAGCTGCCTCTGG + Intergenic
1140280589 16:73551112-73551134 CCCACCAGCAAAACGGCCTCTGG + Intergenic
1142075559 16:88115681-88115703 CCTTCCATCTGTACTCCCTCTGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1143261794 17:5605019-5605041 TCTTCCAGCAAACCTCTCTGTGG + Intronic
1144720171 17:17463581-17463603 CCTTCCAGGGTTACTCCCTCAGG + Intergenic
1144754837 17:17673105-17673127 GCTTCCAGCAAAACTCCTGGAGG + Intergenic
1145755662 17:27388456-27388478 CCTTCCAAAAAAACTCCTTGAGG - Intergenic
1145902333 17:28496988-28497010 CCTACCAGCAAAATTCTCTCTGG - Intronic
1150536900 17:66052402-66052424 CCTTCCAGCAAAACTGTTCCAGG + Intronic
1158212941 18:55070443-55070465 TCTTCCATGAAACCTCCCTCCGG + Intergenic
1161008451 19:1948130-1948152 CCTTCCAGAATGGCTCCCTCCGG - Intronic
1164137967 19:22431121-22431143 TCTTTCAGCAAAACACCCCCAGG + Intronic
1165393517 19:35551446-35551468 CCTTCCAGCAAGGCTTCTTCAGG - Exonic
1167679670 19:50911485-50911507 ACTTCCAGCTCAACTCTCTCAGG + Intergenic
925098192 2:1224168-1224190 CCTTCCAACACGACTGCCTCGGG + Intronic
925125196 2:1449447-1449469 CATTCCAGCAAAACTCCATCAGG - Intronic
930699833 2:54448409-54448431 CACTCCAGCAAAACTCTGTCTGG - Intergenic
932871586 2:75405405-75405427 CTTTCCTGAAAATCTCCCTCTGG + Intergenic
933762853 2:85685196-85685218 CCTTCCAGCTGGACTCCCTTAGG - Intronic
939071439 2:137549028-137549050 TCTTCCAGCAAAAGTCCATAAGG + Intronic
939295841 2:140263255-140263277 TCTTCCAGCCAAACTGCATCTGG + Intronic
941485845 2:166081214-166081236 CCTTACAGTTAAACTCCCTTGGG + Intronic
944638799 2:201701019-201701041 CCTGCATGCAAAACTTCCTCAGG + Exonic
946145147 2:217725040-217725062 ACATCCAGCAAAACCCCCTCAGG - Intronic
947525186 2:230873303-230873325 CTTTCCCCCAAGACTCCCTCCGG + Intronic
947536338 2:230942457-230942479 CCTTCCTGCAAAACGTCCTGGGG - Intronic
947952928 2:234163556-234163578 CCCTCCAGCAATACTCAATCTGG - Intergenic
948037723 2:234872840-234872862 CCTTCCAGCCACACCTCCTCAGG - Intergenic
948283320 2:236765351-236765373 CTTTCCAGAAAAACACCCTCAGG + Intergenic
948532349 2:238617495-238617517 CTTTCCAGCAAGCTTCCCTCTGG + Intergenic
1169025584 20:2368402-2368424 ACTCCAAGCAAAACTTCCTCAGG - Intergenic
1169310282 20:4532215-4532237 CCTTCCAGCTGTGCTCCCTCAGG + Intergenic
1172930931 20:38586084-38586106 CCTTCCAGCAAAACTCAGCTGGG - Exonic
1173388696 20:42611936-42611958 ACTTCCAGGAAATCTCCCTTTGG + Intronic
1176901926 21:14452690-14452712 CCTGCTAGCAAATATCCCTCTGG - Intergenic
1181549067 22:23626102-23626124 GCATCCAGCAAAGCTCCCTGAGG - Intronic
1182035953 22:27198522-27198544 CCTTCCAAATAAACTCCCACTGG - Intergenic
1184389764 22:44196551-44196573 CCTGCCAGCAACAGTCCCACCGG - Intronic
1184892169 22:47386795-47386817 GTTTCCAGAAAAACTCCCACTGG - Intergenic
949280873 3:2344963-2344985 CCTGACATCAAAAGTCCCTCGGG - Intronic
950468663 3:13171342-13171364 CCTCCCAGGAAATCTGCCTCTGG - Intergenic
950940488 3:16885426-16885448 CCTTCCACCACCACTCCCCCAGG - Intronic
952818641 3:37467075-37467097 CCATCCAGCAAGACTACCGCAGG - Intronic
953970582 3:47343994-47344016 CCTTCCAGGAACAGTCCCTCAGG + Exonic
953983246 3:47423282-47423304 GCTGCCAGAAAAGCTCCCTCTGG - Intronic
958775459 3:98477812-98477834 CCTTAAAGCATAACTCTCTCAGG - Intergenic
962673561 3:137734508-137734530 GCTTACAGCAAAACTCCCACAGG - Intergenic
965955403 3:174362940-174362962 CCTTCCAGCCAAAGACCATCAGG + Intergenic
968237323 3:197041416-197041438 CATTCCAGCAAAATACGCTCTGG - Intergenic
968691552 4:1992767-1992789 CCTTCGAGCCAACTTCCCTCAGG - Intronic
969581450 4:8067897-8067919 CCTTCCAGCTAAATGTCCTCTGG - Intronic
973864068 4:55094297-55094319 CCTTCCAACCATACTTCCTCAGG - Intronic
975983388 4:80183540-80183562 CCCTCCAGCCATTCTCCCTCCGG - Intergenic
979947205 4:126847492-126847514 CCTACCAGCAACATTCCCTGTGG + Intergenic
988192965 5:27963561-27963583 CCTGCCAGCACAAGTCCCTCGGG - Intergenic
995369739 5:111405731-111405753 TCTTATAGCAAAAGTCCCTCAGG - Intronic
998377905 5:141703160-141703182 CCTTTCATTAAAACACCCTCCGG - Intergenic
998850111 5:146344059-146344081 CCTTCCAGCCGAATCCCCTCTGG + Intergenic
999187817 5:149725943-149725965 CCTTCCAGCAACCCTCCGTAGGG - Intergenic
999596732 5:153213772-153213794 CCTTCCTGCAAAGCTTTCTCAGG - Intergenic
1000108201 5:158080754-158080776 CTATCCTGCAAAACACCCTCAGG + Intergenic
1000560500 5:162782815-162782837 CCTTCCCTCAACACTCCCCCAGG - Intergenic
1001656242 5:173352612-173352634 CCTACCTGCACACCTCCCTCAGG - Intergenic
1003030560 6:2597078-2597100 CCTTCCTGCCAACCTGCCTCTGG + Intergenic
1004471376 6:15932478-15932500 ACTTCCCGCAACACTCCATCTGG + Intergenic
1005502879 6:26445364-26445386 CCTTCCTGCAAGATTCCCTCAGG + Intronic
1006276686 6:33009755-33009777 CCATCCTCCAAAACTTCCTCTGG - Intergenic
1007707477 6:43799612-43799634 CCTTCAAGCACAACCCCCACGGG - Intergenic
1008487889 6:52054950-52054972 CACTCCAGCAAAACTCACTCTGG + Intronic
1008846340 6:55968660-55968682 GCTGCCAGCAAAACTTTCTCTGG - Intergenic
1011816822 6:91201282-91201304 TCTTCCAGCAAGTCTCTCTCAGG - Intergenic
1012018854 6:93890204-93890226 CCTTCTTGCAACACTCCCTATGG + Intergenic
1014191997 6:118506886-118506908 CTTTCTAGAACAACTCCCTCAGG + Intronic
1015409420 6:132876179-132876201 CATTCCAGCAAAACTGTCTTAGG + Intergenic
1017750476 6:157486709-157486731 CCTTCCAGCACGACCTCCTCTGG - Intronic
1018443049 6:163830857-163830879 CATTGCACCAAAACACCCTCAGG - Intergenic
1019544152 7:1565159-1565181 GCTTCCACCCAACCTCCCTCGGG - Intergenic
1022533669 7:31082672-31082694 TCTTCCAGCAAATCTGTCTCAGG - Intronic
1024768136 7:52685512-52685534 CCTTCCAGTAAAACTCAAGCTGG + Intergenic
1033840378 7:145366302-145366324 CCTTCCTGCAAATCTCACTTAGG - Intergenic
1034885933 7:154798951-154798973 CCTCCCAGGAAAACCCCCTTAGG - Intronic
1035341476 7:158165306-158165328 CCCTCCAGCACCTCTCCCTCTGG - Intronic
1035386372 7:158475528-158475550 ACCCCCAGCAAAACACCCTCGGG + Intronic
1036439454 8:8767469-8767491 CCTTCCAGCAACATGCACTCGGG + Intergenic
1036944008 8:13077534-13077556 CCTTCCATCAAAGCTGACTCTGG + Intergenic
1037281228 8:17244881-17244903 CCCTCCAGCCAAAATCCATCAGG - Intronic
1037359506 8:18058239-18058261 CCTGCCAGGACAAATCCCTCCGG - Intronic
1040017358 8:42710538-42710560 CCTTCCCACAAATCTCCCTGAGG - Intronic
1040690105 8:49927278-49927300 ACGTCCAGCAAAACTGGCTCAGG + Intronic
1047987942 8:130255986-130256008 CTTTCAAACAAAGCTCCCTCAGG + Intronic
1048430884 8:134369575-134369597 TCCTCCAGCAAACCTCCCTCTGG + Intergenic
1049385216 8:142339725-142339747 CTTTCCCGCAGACCTCCCTCGGG - Intronic
1049720388 8:144112853-144112875 TCTTCCAGGAAAAGTCCCTAGGG - Intronic
1052915481 9:33921973-33921995 CCTTCCACCAAATCTTCATCTGG - Exonic
1053886665 9:42649339-42649361 TTTTCCAGAAAAAGTCCCTCGGG - Intergenic
1054117542 9:61179816-61179838 CCTTGCAGCAAAATTCTTTCTGG - Intergenic
1054225684 9:62456789-62456811 TTTTCCAGAAAAAGTCCCTCGGG - Intergenic
1054590213 9:67002750-67002772 CCTTGCAGCAAAATTCTTTCTGG + Intergenic
1058221980 9:102314059-102314081 CCTTCCAGCAAAATTCTGCCTGG - Intergenic
1058543435 9:106035883-106035905 CATTCCAGCACAACTCCATAAGG - Intergenic
1060816560 9:126638301-126638323 CCTCCCAGGGAAACTCCATCCGG - Intronic
1061524778 9:131150423-131150445 ACTTTCAGAAAAACACCCTCAGG - Intronic
1185966788 X:4614674-4614696 CCTCCCATCAGCACTCCCTCTGG - Intergenic
1186747648 X:12585671-12585693 CATTTCAGCAAAAGTCACTCTGG + Intronic
1189305568 X:39984442-39984464 ACAGCCAGCAAAACTCCCTCAGG + Intergenic
1195364913 X:104116384-104116406 CCTCCCAGGCAAACTCCCTCAGG - Intronic
1195605602 X:106802749-106802771 CCTCCCACCAAATCTTCCTCAGG - Exonic
1198472567 X:136961925-136961947 TCTTCCAGCCAAACTCCTGCTGG - Intergenic