ID: 1076674217

View in Genome Browser
Species Human (GRCh38)
Location 10:132139977-132139999
Sequence CCTGGAGGGTCCCCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076674209_1076674217 4 Left 1076674209 10:132139950-132139972 CCCTAAAGATGCAGACGTCGGGG 0: 1
1: 0
2: 1
3: 1
4: 42
Right 1076674217 10:132139977-132139999 CCTGGAGGGTCCCCAAAGGCAGG No data
1076674211_1076674217 3 Left 1076674211 10:132139951-132139973 CCTAAAGATGCAGACGTCGGGGT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1076674217 10:132139977-132139999 CCTGGAGGGTCCCCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076674217 Original CRISPR CCTGGAGGGTCCCCAAAGGC AGG Intronic
No off target data available for this crispr