ID: 1076674660

View in Genome Browser
Species Human (GRCh38)
Location 10:132141781-132141803
Sequence GGGTCTCTCTAGCAGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076674660_1076674675 20 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674675 10:132141824-132141846 CTGGGGAGAAGGGAAGCCCCGGG 0: 1
1: 1
2: 4
3: 62
4: 547
1076674660_1076674669 2 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674669 10:132141806-132141828 CCATACACCATTTGATATCTGGG 0: 1
1: 0
2: 9
3: 185
4: 2311
1076674660_1076674674 19 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674674 10:132141823-132141845 TCTGGGGAGAAGGGAAGCCCCGG 0: 1
1: 1
2: 7
3: 44
4: 506
1076674660_1076674672 9 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674672 10:132141813-132141835 CCATTTGATATCTGGGGAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 230
1076674660_1076674670 3 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674670 10:132141807-132141829 CATACACCATTTGATATCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 143
1076674660_1076674676 21 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674676 10:132141825-132141847 TGGGGAGAAGGGAAGCCCCGGGG 0: 1
1: 1
2: 4
3: 39
4: 450
1076674660_1076674667 1 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674667 10:132141805-132141827 CCCATACACCATTTGATATCTGG 0: 1
1: 0
2: 0
3: 11
4: 107
1076674660_1076674673 10 Left 1076674660 10:132141781-132141803 CCCTCATGCTGCTAGAGAGACCC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1076674673 10:132141814-132141836 CATTTGATATCTGGGGAGAAGGG 0: 1
1: 1
2: 1
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076674660 Original CRISPR GGGTCTCTCTAGCAGCATGA GGG (reversed) Intronic
904157685 1:28498242-28498264 GGGTCTCTGGAGAAGCAAGAAGG + Exonic
906542640 1:46599620-46599642 GGTTTTCTCTGGCAGCAGGACGG - Intronic
907111645 1:51931804-51931826 GGGTCTCACCAGCTGGATGAGGG + Intronic
907242444 1:53088243-53088265 AGGTCTTTGTAGCAGCAGGAGGG + Intronic
908405314 1:63808684-63808706 GGGTCTCTCTGGCTGCAAGGAGG + Intronic
908502484 1:64758042-64758064 GGGTTTCTCTAGTAGCTGGAAGG + Intronic
909605071 1:77499738-77499760 GGGTCTCTCTAGGAGTCTGATGG - Intronic
911395926 1:97309895-97309917 GGGTCTCAAAAGCAGCAGGATGG - Intronic
913551616 1:119922308-119922330 GGCTCTCTCTGGCTGCCTGAAGG - Exonic
914230359 1:145760444-145760466 GGGTCCCTCTCACAGCATGTGGG - Intronic
917731204 1:177876790-177876812 GGGTCTCTCCCACAACATGAGGG - Intergenic
921681648 1:218040290-218040312 GGGTCTCTTTTTGAGCATGATGG - Intergenic
922789413 1:228302869-228302891 GGGTCAGTCTAGCAGTATGTTGG + Intronic
923221232 1:231895996-231896018 GGGTTTCTCTAGCATCATACAGG + Intronic
923794639 1:237142163-237142185 GGGTGGCTCCAGCAGCCTGAGGG + Intronic
1068248778 10:54408966-54408988 GGGTCCCTCTCACAACATGAGGG - Intronic
1071151690 10:82643188-82643210 GGGTCCCTCTGGCAACATGTGGG - Intronic
1072541606 10:96402538-96402560 GGCGCTCTCTAGCAGCCAGAAGG - Intronic
1074159167 10:110822870-110822892 CGGTTTCTCTAGCAACAAGAAGG - Intronic
1074431137 10:113395798-113395820 GTGTCTCTCTAGGACTATGAGGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1081084643 11:38784958-38784980 GGGTCTCCCTAGAAGTATGGAGG - Intergenic
1083277079 11:61602971-61602993 AGGTCTCTCCATCTGCATGATGG - Intergenic
1084198914 11:67542431-67542453 GGGACTCCCTAGCAGCATATGGG + Intergenic
1087556500 11:99728503-99728525 GGGTCTATCTAACTGAATGAAGG + Intronic
1088435124 11:109804133-109804155 GGGTCTCTCTCACAACATGTAGG + Intergenic
1088537275 11:110874990-110875012 GGGTCTCTCATCCAGCATGGGGG + Intergenic
1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG + Intronic
1091134552 11:133177019-133177041 GGGTCCCGCTGGCAGGATGATGG - Intronic
1093624099 12:21326011-21326033 GGGTCCCTCTCACAGCATGTGGG - Intronic
1095655875 12:44668514-44668536 AGGTCTCTCAAGAACCATGATGG - Intronic
1096842801 12:54389774-54389796 GGGTCACTCTAGCATCAGGGTGG + Intronic
1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG + Intergenic
1100739452 12:97575392-97575414 GGATCTCTCTAGCTGCAGGGTGG + Intergenic
1100743643 12:97622363-97622385 GGGTCTCTTTAGCAGTCTCAGGG + Intergenic
1105280768 13:18961399-18961421 GAGTCTGCCCAGCAGCATGAGGG - Intergenic
1110377971 13:74815213-74815235 AGGTCTCTCCAGCAACATGTGGG - Intergenic
1111806782 13:93048225-93048247 GGGCCTCTCTAGCAAGATTAGGG + Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1115861044 14:37686809-37686831 GGGTCTCTCACACAACATGAGGG + Intronic
1118806399 14:69240955-69240977 GCGGCTCTCCAGCTGCATGAGGG - Exonic
1120213022 14:81653035-81653057 GGGTCTCTCCTGCAACATGTGGG - Intergenic
1120442477 14:84558162-84558184 GGGTCTCTCTCACAACATGGGGG + Intergenic
1121793192 14:96714188-96714210 GGGTCTCCCTAGCACAGTGAGGG - Intergenic
1130416747 15:83701532-83701554 GGGTCTCTCCCACAGCATGTGGG - Intronic
1131116554 15:89799662-89799684 GCGTCTCCCCAGCAGCTTGAGGG - Intronic
1131222777 15:90598851-90598873 GGGGCTCTCTACCAGGAAGACGG + Intronic
1133551885 16:6864119-6864141 GAGTCTCTTTAGCAGGAAGAAGG + Intronic
1133895120 16:9919810-9919832 GGGTCTGAGGAGCAGCATGATGG - Intronic
1133981445 16:10635865-10635887 GGACCTTTCCAGCAGCATGATGG + Exonic
1138859851 16:60743481-60743503 GGGTCTCTCTCACAACATGTGGG + Intergenic
1139494104 16:67303421-67303443 GGGTCTCTCTAGCATCCTCTGGG - Intronic
1145727355 17:27143306-27143328 GGGTCCCTCTCACAACATGAAGG - Intergenic
1148345750 17:46902761-46902783 GGCTCTCTCTATCAGGAAGAAGG - Intergenic
1150508709 17:65725864-65725886 GGGTCCCTCTCGCAACATGTGGG + Intronic
1152600105 17:81257955-81257977 TGCTCTCTCTAGCACCCTGAAGG - Intronic
1153394429 18:4602458-4602480 AGGTCACTTTAGCAACATGATGG - Intergenic
1153430763 18:5014378-5014400 GGGTCTGTACACCAGCATGAGGG - Intergenic
1153880255 18:9416163-9416185 GGGCCTCCCCAGCAGCATTAGGG - Intergenic
1155665893 18:28307756-28307778 GGGTCCCTCCCACAGCATGAGGG - Intergenic
1159329071 18:66965355-66965377 TGCTCTCTTTAGCTGCATGATGG + Intergenic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1160353125 18:78201929-78201951 GGGGCTCTGTAGGAGCATGGAGG - Intergenic
1162964319 19:14148857-14148879 GGGGCTTTCTAGCAGCAAAAAGG + Exonic
1165844574 19:38809926-38809948 GGGACCCTCTGGCTGCATGAGGG - Intronic
1166113626 19:40639320-40639342 GAGTCCCTCTATCTGCATGACGG - Intergenic
1167820994 19:51927551-51927573 GGGTCTGTCTGTCAGGATGAGGG + Intronic
1168030659 19:53677164-53677186 GGGTCTCTCTAGTAACAGGTGGG + Intergenic
1168309726 19:55454447-55454469 GGGCCTCTCCAGCATCCTGAGGG + Intronic
926132178 2:10310588-10310610 GGGTCTCTGTAGGTGCATCAGGG - Intronic
927013148 2:18927447-18927469 GGGTCCCTCTCACAACATGAGGG + Intergenic
928897079 2:36278431-36278453 GGTTCTCTACAGCAGCATAAAGG + Intergenic
934732570 2:96668874-96668896 GTTTCTCTCTAGCCGCAAGAAGG + Intergenic
935881500 2:107570351-107570373 GGCTTTCTCTTGCAGCATGGAGG + Intergenic
936895648 2:117424534-117424556 GGCTCTTTCTATAAGCATGAAGG - Intergenic
937848001 2:126602436-126602458 GGGTCTGTCTTGCAGCCTGTTGG - Intergenic
940193054 2:151062711-151062733 GGGTCTCTCCCGCAACATGTGGG + Intergenic
941662411 2:168208807-168208829 TGTTATCTCTAGCAGCAGGAGGG - Intronic
945418451 2:209604102-209604124 GGATCTCTATAGCAGTAAGAAGG + Intronic
1170194161 20:13673646-13673668 GGGTCTCTCTCACAACATGTGGG - Intergenic
1172963122 20:38812762-38812784 GGGTCTCTGTAGGAGTTTGAAGG + Intronic
1174408813 20:50320770-50320792 GGATCTCTCTGGCTGCATGTGGG - Intergenic
1177267131 21:18799271-18799293 GGGTCCCTCTCACAGCATGTGGG - Intergenic
1180713533 22:17856332-17856354 TGGTCTTTTGAGCAGCATGAAGG + Intronic
1180880788 22:19202304-19202326 GGGTCTCTCTAAATTCATGAAGG + Intronic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
952955216 3:38552726-38552748 GGGGGTCTCAAGCAGGATGAGGG - Intronic
953346807 3:42182679-42182701 GGCTCCCTCTTGCAGGATGATGG - Intronic
953971126 3:47347875-47347897 GGCTATCTCTTTCAGCATGAAGG - Intergenic
954794487 3:53154608-53154630 GGTCTTCTCTAGCAACATGAGGG + Intergenic
955530119 3:59864219-59864241 GGGTCTCTCCCACAGCATGTGGG - Intronic
956916700 3:73879476-73879498 GAGTCTCTCTACCAGCAAGAAGG + Intergenic
964228000 3:154429249-154429271 GGGCCTCTCTAGCAACTTGAAGG - Exonic
964923544 3:161927265-161927287 GGGTCTCTCTCACAACATGTGGG - Intergenic
965190349 3:165519942-165519964 GGTTCTCTCTATCAGCCTTAAGG + Intergenic
965711864 3:171563597-171563619 GGGCCTCTCCTGCAGCATGGTGG + Intergenic
967100584 3:186212158-186212180 AGGTCTCTGTAGCTGCATTAAGG + Intronic
969070003 4:4528719-4528741 GTGTGTCTCAAGCAGCAGGAAGG + Intronic
969116538 4:4873866-4873888 GGGCCTCTCTCTCAGCAAGAGGG - Intergenic
971259325 4:25042153-25042175 GGGTCCCTCTTACAACATGAGGG + Intergenic
972059210 4:34847235-34847257 GGCTCTCTGCAGCAGAATGAGGG + Intergenic
972722974 4:41719359-41719381 TGATCTCTCTAGCTGCAGGAGGG + Intergenic
976881774 4:89933744-89933766 GGGTCTCTCTCACAACATGTGGG + Intronic
979892001 4:126109800-126109822 GGGTCTCTCACACAGCATGCGGG + Intergenic
981694754 4:147549135-147549157 GGGTCTATCCCGCAGCATGTGGG - Intergenic
983170112 4:164526029-164526051 GGGTATGTCTTGCAGCATGAAGG - Intergenic
983469579 4:168140051-168140073 TGGTCTCTATAGCTGCATGCTGG - Intronic
984137241 4:175956025-175956047 GGGTTGCCCTAGCAGCATGTTGG - Intronic
986183021 5:5411212-5411234 GTGTGTCTCTACCAGCAAGAAGG + Intergenic
986431678 5:7687477-7687499 GGTTCTCTTTAGCAGGGTGAGGG + Intronic
987150093 5:15029702-15029724 AGGTCTCTCTACCTCCATGAAGG + Intergenic
993589007 5:89770625-89770647 GGGTCTCTCCCGCAACATGTAGG - Intergenic
995387536 5:111604431-111604453 TGGTCACTCTAGCATCATTATGG + Intergenic
995491493 5:112696914-112696936 GGGGAGCTGTAGCAGCATGAAGG + Intergenic
999198824 5:149801767-149801789 GGGTCTGTCTCAGAGCATGAAGG + Intronic
1000573922 5:162952135-162952157 GGGTCCCTCCCCCAGCATGAGGG + Intergenic
1001868213 5:175124411-175124433 TGATCTCTCTGGCAGCAGGAAGG + Intergenic
1004311848 6:14553062-14553084 AGGACTCTCTAGAAGCGTGATGG - Intergenic
1009760106 6:67994492-67994514 GTGCCTTTCTAGCAGCATGTTGG - Intergenic
1011555307 6:88566795-88566817 GGGGGGCTCTAGCAGCATGGGGG - Intergenic
1012724189 6:102787120-102787142 GGGTCTCTCCAACAACTTGAAGG + Intergenic
1013858240 6:114601997-114602019 GGGTCTTTCTAGAGGCATGTTGG - Intergenic
1018558858 6:165079227-165079249 GGGTCTCTCCCACAGCATGTGGG + Intergenic
1019657597 7:2204590-2204612 GGGTCTCTCTTGCTGAGTGAAGG - Intronic
1021040700 7:15858354-15858376 GGGTCCCTCCCACAGCATGAGGG - Intergenic
1026671126 7:72391572-72391594 GGGTCTCTCCCACAGCATGTGGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029290725 7:99500338-99500360 GGGCCTCTCTAGGCGCCTGATGG + Intronic
1030679185 7:112416236-112416258 GTGACACCCTAGCAGCATGAAGG + Intergenic
1031674083 7:124588081-124588103 AGGTCTCTCTGACAGCATGTGGG - Intergenic
1032114196 7:129103105-129103127 GGGTCTCTCTGACTACATGAGGG - Intergenic
1032916419 7:136495195-136495217 AGGTCTCTGGAGCAGCCTGATGG - Intergenic
1034485347 7:151357430-151357452 GGGCCTCTATAGCAGCATTCTGG + Intronic
1035053750 7:156019936-156019958 GGGTCTCACTAGGACCTTGAGGG + Intergenic
1035582230 8:747564-747586 GGGGCTCTGCAGCAGTATGAGGG + Intergenic
1035588304 8:794006-794028 GGGTGTTTCTAGCTGCAGGATGG + Intergenic
1035588445 8:794872-794894 GGGTATTTCTAGCTGCAGGACGG + Intergenic
1042843529 8:73148184-73148206 GGGTCTCTATGGCAGCAGCAGGG + Intergenic
1043788551 8:84433501-84433523 GGGTCTCTCCCGCAACATGTGGG - Intronic
1044694164 8:94906157-94906179 AGGACTCTATAGCAGCCTGATGG - Intronic
1048497332 8:134946231-134946253 CGGTCTCTTTAGGAGGATGAGGG + Intergenic
1048785786 8:138048729-138048751 GTGTCTTTATAGCAGCATGGTGG + Intergenic
1186262765 X:7797962-7797984 GGGTCTCTCCAACAACATGTGGG - Intergenic
1189362114 X:40360720-40360742 GGGTGTCGCTGGCAGCATGGCGG - Intergenic
1190217638 X:48490612-48490634 GGGGCTCTGGAGCAGCAGGAGGG + Intergenic
1191120925 X:56904101-56904123 GGGTCCCTCCTGCAACATGAAGG - Intergenic
1194608955 X:96017216-96017238 GGGTCTCTCTAGGGGAAAGAGGG - Intergenic
1195263522 X:103157633-103157655 GGATCTCTCTAACAGCATGAAGG - Intergenic
1197169053 X:123410840-123410862 GTGTCTCTGTAGCTGGATGAAGG - Intronic
1200167431 X:154046495-154046517 GGCTCACTCTAGCTGCACGAGGG - Intronic
1201510731 Y:14758659-14758681 GGGTCTCTCTGTCACCATGCTGG + Intronic