ID: 1076674770

View in Genome Browser
Species Human (GRCh38)
Location 10:132142208-132142230
Sequence AAACCAGGGATTGGGGATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 201}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076674762_1076674770 -6 Left 1076674762 10:132142191-132142213 CCCATGGAAGCCGATCAAAACCA 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674757_1076674770 18 Left 1076674757 10:132142167-132142189 CCCTTGCCTGCAGTCCTGGTGGT 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674761_1076674770 4 Left 1076674761 10:132142181-132142203 CCTGGTGGTGCCCATGGAAGCCG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674753_1076674770 27 Left 1076674753 10:132142158-132142180 CCTCTCCTGCCCTTGCCTGCAGT 0: 1
1: 0
2: 2
3: 48
4: 498
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674759_1076674770 12 Left 1076674759 10:132142173-132142195 CCTGCAGTCCTGGTGGTGCCCAT 0: 1
1: 0
2: 2
3: 18
4: 188
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674752_1076674770 30 Left 1076674752 10:132142155-132142177 CCTCCTCTCCTGCCCTTGCCTGC 0: 1
1: 2
2: 10
3: 118
4: 1239
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674758_1076674770 17 Left 1076674758 10:132142168-132142190 CCTTGCCTGCAGTCCTGGTGGTG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674763_1076674770 -7 Left 1076674763 10:132142192-132142214 CCATGGAAGCCGATCAAAACCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201
1076674754_1076674770 22 Left 1076674754 10:132142163-132142185 CCTGCCCTTGCCTGCAGTCCTGG 0: 1
1: 0
2: 2
3: 50
4: 434
Right 1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG 0: 1
1: 0
2: 2
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076674770 Original CRISPR AAACCAGGGATTGGGGATCC CGG Intronic
901199538 1:7458690-7458712 GCATCAGGGTTTGGGGATCCAGG + Intronic
902165171 1:14564299-14564321 AAACCTGTGATTGTGAATCCAGG + Intergenic
902209467 1:14894263-14894285 AAAGCAGGGATGGAGGATGCAGG - Intronic
904316373 1:29668667-29668689 AAACCAGGCAATTGAGATCCGGG + Intergenic
905417180 1:37812013-37812035 GCACCAGGGATTGGGGTTCATGG - Exonic
906108448 1:43308302-43308324 GACCCAGGGATTGGGGACTCAGG + Intronic
906108464 1:43308352-43308374 GACCCAGGGATTGGGGACTCAGG + Intronic
906108480 1:43308402-43308424 GACCCAGGGATTGGGGACTCAGG + Intronic
906108498 1:43308452-43308474 GACCCAGGGATTGGGGACTCAGG + Intronic
907336490 1:53703013-53703035 AGAGCAGAGATTGGGGAGCCTGG - Intronic
909894657 1:81052326-81052348 AAGTTAGGGATTAGGGATCCAGG - Intergenic
911394868 1:97292798-97292820 AAACAAGGGTTTGGGGATCTGGG + Intronic
914755181 1:150558299-150558321 GAACCAGGGACTGGGGGCCCAGG + Intronic
915282474 1:154832004-154832026 AACCCAGGTGTTGGGGCTCCCGG + Intronic
916454116 1:164953034-164953056 AAGCCAGGCATTGGGGAAACTGG + Intergenic
918343926 1:183590212-183590234 AAATCCGGGAGTGGGGGTCCTGG + Exonic
923215765 1:231846264-231846286 TAACCAGTGATGGAGGATCCAGG + Intronic
924099195 1:240585831-240585853 AAACCAAGGATTGGCCTTCCTGG - Intronic
1066280000 10:33907036-33907058 AATCCAGGGATTTCTGATCCAGG - Intergenic
1067105616 10:43364085-43364107 GATCCAGAGATTGGGAATCCAGG + Intergenic
1069653098 10:70065710-70065732 AAACCAGGTATTGGATCTCCTGG - Intronic
1069729677 10:70602614-70602636 AGAGCAGGGATTGGGGGGCCTGG - Intronic
1070450829 10:76555361-76555383 AAACCAGAAATTGGGGATTAGGG + Intronic
1070725371 10:78784062-78784084 TACCAGGGGATTGGGGATCCAGG - Intergenic
1070820296 10:79350387-79350409 AGATCAGGGATTGGGTGTCCTGG + Intronic
1071503476 10:86219376-86219398 AAACCAGGTATTTGGGCTACAGG + Intronic
1074584112 10:114749915-114749937 AAAGCAGGGATCGGGGATGGAGG - Intergenic
1074665578 10:115719503-115719525 AAACCAGGGATTGTCTATGCTGG + Intronic
1075585741 10:123656842-123656864 AAACCAGGAGTTCGGGATGCTGG - Intergenic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1080060419 11:27950827-27950849 ATAGTAGGGATTAGGGATCCAGG - Intergenic
1081571714 11:44295560-44295582 CAACCAGGGGCTGGGGCTCCAGG - Intronic
1082660378 11:55902474-55902496 AAATCTGGGGTTGGTGATCCTGG + Intergenic
1084525522 11:69695484-69695506 AAAGCAGGGAGAGGGGATGCAGG + Intergenic
1085803797 11:79616021-79616043 ATACAAGGGAATGGGGCTCCGGG + Intergenic
1089199754 11:116716973-116716995 AAAACAGGGGTAAGGGATCCCGG + Intergenic
1090468499 11:126956915-126956937 AAAACAGGGCCTGGTGATCCTGG - Intronic
1096674092 12:53217252-53217274 AGACTAGGGATGGGGGCTCCAGG + Intronic
1098609089 12:72432640-72432662 AAGCCTGGGTTTGGGGATCCAGG + Intronic
1099315567 12:81078452-81078474 TTACCAGGGATGGGGGATCAGGG - Intronic
1101276121 12:103203259-103203281 AATCACGGGATTGGGGATCAGGG - Intergenic
1105435632 13:20375795-20375817 AAGACAGAGATTGGGGTTCCAGG + Intergenic
1106089739 13:26579730-26579752 AAACCAGGAAATGGCGCTCCTGG + Intronic
1106361522 13:29035645-29035667 AAAACAGGGATTGAGGAGCAAGG - Intronic
1107195573 13:37647393-37647415 AAACAAGGGATTCGGGACACAGG + Intronic
1109426458 13:62170534-62170556 ATACCAAGAATTGGGGATCATGG + Intergenic
1109588590 13:64444265-64444287 GAACCAGGGATTGTGCTTCCAGG - Intergenic
1112315721 13:98360537-98360559 AAGCCAGGGATGGGGGCTCTAGG + Intronic
1113157250 13:107337712-107337734 TATCCAGGGATTAGGGATCATGG + Intronic
1119449178 14:74693710-74693732 AAAGCAGGGATTCTGGGTCCAGG - Intronic
1120184754 14:81383189-81383211 AAACCAGGCAGTCTGGATCCAGG - Intronic
1121695480 14:95908836-95908858 GACCCAGGGATTTGGGTTCCAGG - Intergenic
1122218832 14:100222380-100222402 AAACAATGGGCTGGGGATCCGGG + Intergenic
1124406650 15:29398795-29398817 ACACCAGGGAGTGGGGACCTTGG - Intronic
1125457054 15:39870614-39870636 AGACCAGGGATTGGGAATCTGGG - Intronic
1125927631 15:43576331-43576353 ATTCTAGGAATTGGGGATCCAGG + Intronic
1125940774 15:43675896-43675918 ATTCTAGGAATTGGGGATCCAGG + Intergenic
1127227190 15:56943875-56943897 ATGCCTGGGGTTGGGGATCCAGG - Intronic
1127952045 15:63817734-63817756 AATCCAAGGATTGGGGATGAGGG + Intronic
1129077072 15:73006074-73006096 AAACCAGGGATAGAAGATACGGG - Intergenic
1129300811 15:74624447-74624469 CAAACAGGGATGGGGGTTCCAGG - Intronic
1129368126 15:75069500-75069522 AAACCAGGGATTGGGAATAGTGG + Intronic
1130689071 15:86064632-86064654 ACACCAGGAGGTGGGGATCCAGG + Intergenic
1134387769 16:13789917-13789939 AAACCAGGCATCCTGGATCCAGG - Intergenic
1136656130 16:31710353-31710375 AAAACAGGGATAGGGCATTCTGG + Intergenic
1136910692 16:34141943-34141965 ACACCAGGGCTTGGGGAACTGGG - Intergenic
1136910750 16:34142459-34142481 ACACCGGGGAGTGGGGAACCGGG + Intergenic
1137232708 16:46582368-46582390 ATACCAGGGGGTGGGGATCATGG - Intronic
1138577890 16:57920247-57920269 AATCCAGAGAGTGGGGATCTGGG + Intronic
1139036660 16:62955639-62955661 ACACCAGGGAGTGGGAATCTTGG - Intergenic
1139355005 16:66362342-66362364 CAGCCTGGGAATGGGGATCCAGG - Intergenic
1139563855 16:67760624-67760646 ACAGCAGGGATTGGGGATAGGGG - Intronic
1141660309 16:85437747-85437769 AGATCAGGGCTGGGGGATCCAGG + Intergenic
1143345272 17:6244586-6244608 AAAGCAGGGATGGGGGCTCGGGG - Intergenic
1146206044 17:30906405-30906427 CAGCCAGGGACTCGGGATCCGGG - Exonic
1147133960 17:38424724-38424746 AACCCAGGCATTTGGGCTCCAGG - Intergenic
1148444787 17:47730975-47730997 AAATCGGGGATTGAGGAACCAGG + Intergenic
1149259581 17:54864305-54864327 AAACCAGGGAATGTGGATCCAGG - Intergenic
1150223931 17:63512619-63512641 AAACCAAGGTTTGGAGATCAGGG - Intronic
1150475593 17:65472151-65472173 AAACCAGGACCTGGGGCTCCAGG + Intergenic
1151331088 17:73409112-73409134 AAAGCTGGGAATGGGGATACAGG + Intronic
1151772034 17:76170016-76170038 ACAGCAGGACTTGGGGATCCTGG + Intronic
1157282345 18:46354268-46354290 AGGCCAGGGATTGGGGGTCTGGG + Intronic
1158444985 18:57511777-57511799 ATCCCAGGGAGAGGGGATCCAGG + Intergenic
1158907451 18:62027523-62027545 AAAGCAGGGAGTGGGCTTCCAGG + Intergenic
1162134660 19:8548000-8548022 CAGTCAGGGATGGGGGATCCTGG - Intronic
1163152288 19:15422587-15422609 AACCCAGGAACTGGGGGTCCGGG + Exonic
1164945132 19:32286992-32287014 CACCCAGGGGTTGGGGACCCCGG + Intergenic
1165108532 19:33488156-33488178 AAACTGGGAATTGGTGATCCTGG + Intronic
1166231350 19:41427243-41427265 ACCCCAGGGACTGGGGAACCAGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167560122 19:50221964-50221986 ACACCAGGGTTTTGGAATCCTGG + Intronic
1168522824 19:57066060-57066082 AAGCCAGGGATTTTGGACCCAGG - Intergenic
925445650 2:3924552-3924574 GGCCCAGGGGTTGGGGATCCCGG + Intergenic
926250740 2:11154479-11154501 AAACCAGGGATCGTGGATTCTGG + Intergenic
928329992 2:30350332-30350354 AAACCAAGGCTTGGGGTTTCTGG + Intergenic
930509387 2:52325817-52325839 ACACCAGGGCTAGGGAATCCTGG + Intergenic
930753534 2:54954285-54954307 AAACAGGGCACTGGGGATCCTGG + Intronic
932362316 2:71118989-71119011 AAAGCAGGGTGTTGGGATCCTGG - Intronic
936040504 2:109145907-109145929 AACCCAGGCATTCGGGCTCCAGG - Intronic
936287791 2:111194516-111194538 TAATCAGGGACTGGGGACCCAGG - Intergenic
937361137 2:121230999-121231021 AACCCAGGGATTGGAGCTGCAGG - Intronic
937539135 2:122926683-122926705 TAGCCGGGGACTGGGGATCCTGG + Intergenic
939197361 2:138989726-138989748 AACACAGGGGTTGGGGATGCTGG + Intergenic
941538663 2:166754784-166754806 AAAGCAGGGATGGGGGATGGGGG - Intergenic
946314332 2:218899505-218899527 AAACTAGGAATTGGGGGACCTGG + Intronic
946801802 2:223425358-223425380 ATACCAAGGAGTGGGAATCCTGG + Intergenic
947355578 2:229291659-229291681 AAAAAAAGAATTGGGGATCCTGG - Intergenic
948496538 2:238353602-238353624 ACACCAGGGTTTGAGTATCCTGG + Intronic
1168897891 20:1336517-1336539 AAACCAGGGCTTGGGGTCCCTGG - Intronic
1171091350 20:22288454-22288476 AAAGCAGGGAGTGGGGCTTCAGG - Intergenic
1171159557 20:22908970-22908992 AAACCCAGGACTGGGGAACCAGG + Intergenic
1172176842 20:32977608-32977630 AGGCCAGGGCTTGGGGATTCGGG + Intergenic
1173708977 20:45138086-45138108 GAATCAGGGACTGGGGATCAGGG + Intergenic
1174496912 20:50952048-50952070 AACCCAGGCATTGTGGTTCCAGG - Intronic
1175548686 20:59801217-59801239 AATCCAGGGAGGGGGAATCCAGG - Intronic
1177142772 21:17376018-17376040 AAACTAGGTATTGGGCTTCCGGG + Intergenic
1179511783 21:41878712-41878734 AAACGCGGGGTTGGGGGTCCAGG + Exonic
1179731679 21:43371778-43371800 AAACCAGGAATTGGTGATCCAGG + Intergenic
1179980447 21:44893007-44893029 GACCCAGGGATTTGGGCTCCAGG + Intronic
1179998640 21:44985263-44985285 AAAGTCGGGAGTGGGGATCCTGG - Intergenic
1180127037 21:45799950-45799972 CAACCAGGCATTGGAGAGCCCGG - Intronic
1183226454 22:36553519-36553541 GGCCCAGGGATTGGGGACCCCGG + Intergenic
1183425293 22:37735856-37735878 AAACCAGGTATGGTGGAGCCAGG - Intronic
1184346151 22:43914511-43914533 AACCCAGAAATTGGGGAACCTGG + Intergenic
949694812 3:6681924-6681946 GGACCAGGAATTGGGGATCCTGG - Intergenic
950563941 3:13753368-13753390 AAATCAGGGCTTTGGCATCCTGG + Intergenic
952239010 3:31510667-31510689 AAACCAGGTGTTGGGAATCATGG - Intergenic
952398713 3:32944001-32944023 ATAGCAGGGATTGGGGGTGCTGG - Intergenic
954198847 3:49012419-49012441 ACACCAGGGACGTGGGATCCGGG + Exonic
954809943 3:53241522-53241544 AAACCAGGGATTAGGGCAGCCGG - Intronic
955112743 3:55965176-55965198 AAACCAGGGGGTGGAGATCATGG + Intronic
955322798 3:57986300-57986322 AAAACAGGGATTTGGCCTCCTGG - Intergenic
955770124 3:62377427-62377449 ACACCACTGACTGGGGATCCGGG + Intergenic
956046949 3:65205846-65205868 AAAGCAGGGATTGAGGATAGTGG + Intergenic
956389170 3:68753241-68753263 ACCCCAGGGGTTGAGGATCCTGG - Intronic
956462507 3:69485656-69485678 CAGCCTGGGGTTGGGGATCCAGG + Intronic
959848808 3:111064309-111064331 AACCCAGGCAATGCGGATCCAGG + Intergenic
960967075 3:123112853-123112875 AAAACAGGGCTTGGGGGGCCGGG - Intronic
961179631 3:124866575-124866597 ATCCCAGGGATTGGGCATGCTGG - Intronic
965734715 3:171808676-171808698 TAACCAGGTAGTGGGGAACCCGG - Intronic
966286224 3:178298675-178298697 AAACAAGGAAATGGAGATCCAGG - Intergenic
970581473 4:17477655-17477677 AAGCCAGGGACAGGGGAGCCTGG + Intronic
971502629 4:27333227-27333249 AAAACAAGGCTTGGGGATCCGGG + Intergenic
972857459 4:43124188-43124210 AAAACAGGTATTGTGGATGCAGG + Intergenic
976194083 4:82516391-82516413 AAACCAGAGAATCTGGATCCAGG - Intronic
976932391 4:90584049-90584071 ACACCAGGGAATGGAGATCTTGG - Intronic
976972685 4:91126867-91126889 AAACCTGGGATTGAAGATACAGG + Intronic
981231071 4:142356461-142356483 AACTCAAGGGTTGGGGATCCTGG + Intronic
983792432 4:171813915-171813937 GATCCAGGGACTCGGGATCCGGG - Exonic
984041993 4:174746479-174746501 ATACCAGGGACTGGGGAGACCGG + Intronic
988786131 5:34567020-34567042 TAATCAGAGATTGGTGATCCAGG + Intergenic
990327246 5:54690660-54690682 AAACCAGTGAGTGGGGCTTCAGG - Intergenic
992997097 5:82344830-82344852 AGACCAGGGAATGAGGACCCCGG - Intronic
993448654 5:88046347-88046369 AAACCAGTGAATGGGACTCCGGG + Intergenic
995855459 5:116586668-116586690 AAACCGGGGTGTGGGGATCAAGG + Intergenic
996487565 5:124055268-124055290 AAGCCAGGGAGTGGGGATTGTGG - Intergenic
997244232 5:132332558-132332580 AATCCAGGCAATGGGGATCTAGG - Intronic
997930586 5:138069497-138069519 AAACAAGGGAGAGGGGATGCAGG - Intergenic
998195932 5:140071356-140071378 AAGCAAGGGAGTGGGGATTCAGG + Intergenic
999786987 5:154899660-154899682 AAAGCAGTGATTGGGAAACCTGG + Intronic
1001754239 5:174155714-174155736 AAGGAAGGGATTGAGGATCCAGG - Intronic
1001963342 5:175893903-175893925 AAGCCAGGGGGTGGGGATGCAGG + Intergenic
1002577474 5:180182885-180182907 ACACCAGGGAGTAGGAATCCAGG - Intronic
1002815800 6:678683-678705 GAACCAGGGCATGGGGCTCCAGG + Intronic
1003809478 6:9763971-9763993 AAACCAGGGGTTGAGGATATGGG - Intronic
1004333986 6:14747390-14747412 ACACCAGAGTTTGGTGATCCTGG - Intergenic
1006613707 6:35311129-35311151 GACCCAGGGATAGGGCATCCTGG + Intronic
1006837498 6:37007806-37007828 AAACCAGGGACTGGGGTGCCAGG + Intronic
1011989519 6:93496552-93496574 AATCAAAGGATTGGTGATCCTGG - Intergenic
1012931951 6:105326741-105326763 AAACCAGAGAATGGGGCTTCCGG - Intronic
1016828091 6:148406565-148406587 AATGCTGGGCTTGGGGATCCAGG + Intronic
1016892510 6:149020685-149020707 AAGCCCGGGAGTGGGGCTCCAGG - Intronic
1018261630 6:161976234-161976256 AAGCCAGGGATTTGGAACCCAGG + Intronic
1019169267 6:170122597-170122619 ATACCAGGGAGTGGGAATCTAGG - Intergenic
1020256882 7:6507475-6507497 AAAACAGGGCATGGGAATCCTGG + Intronic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1024584243 7:50827387-50827409 CTTCCAGGGATGGGGGATCCTGG - Intergenic
1024695816 7:51855691-51855713 AAACCTAGGATTGGTGTTCCAGG - Intergenic
1026181538 7:68045374-68045396 GTACCAGGGATTGGGAACCCCGG + Intergenic
1029736735 7:102469406-102469428 GAAACAGGGATTGGGGGCCCAGG + Intronic
1032189741 7:129757765-129757787 AAACCAGGGAGTGAGGATGCAGG - Intergenic
1032493497 7:132342991-132343013 ACACAAGGGATGGGGGATACTGG + Intronic
1034481071 7:151320831-151320853 AATCCTGGGGCTGGGGATCCAGG - Intergenic
1038868426 8:31465548-31465570 AAAGCAGGGACGGGGGTTCCAGG - Intergenic
1042801555 8:72723539-72723561 ACAGGAGGGATTGGGGCTCCAGG - Intronic
1043383851 8:79730093-79730115 AGACCAGGGATGGGAGAGCCTGG - Intergenic
1044636305 8:94328155-94328177 AAACCAGAGATTGGGTCTTCCGG + Intergenic
1047201945 8:122774727-122774749 TAACCAGGGACTGGGAATCTTGG + Intergenic
1049412137 8:142478128-142478150 AAGCCAGGCATTGGGGTGCCGGG + Intronic
1049422051 8:142521368-142521390 GAACCAGGGATAGGGGGTCTGGG - Intronic
1049445829 8:142631042-142631064 ACACCAGGGAGTGGGGAGCTGGG + Intergenic
1050302469 9:4273796-4273818 AGACAAGAGATTGGGGATCTTGG - Intronic
1051335426 9:16061883-16061905 AAACCAGGGATTTGGAGTTCTGG - Intergenic
1054770540 9:69079223-69079245 AGACCAGGCAATGGGAATCCAGG - Intronic
1056767462 9:89453724-89453746 AAAGCAGGCATTGTGGTTCCCGG - Intronic
1057688989 9:97266089-97266111 AATCCAGGGATTGGTGATGTAGG + Intergenic
1058950567 9:109899843-109899865 AAACCAGGGTTTAGGGCTCAGGG - Intronic
1059044032 9:110844803-110844825 AAACCAGGTATAGGGGATGTGGG + Intergenic
1060349182 9:122842704-122842726 AAACCATGGATGGGTGATCCAGG - Intergenic
1060756965 9:126220562-126220584 AAGCCAGGGACAGGGGAGCCAGG + Intergenic
1060974386 9:127755665-127755687 AAACCAGGGATGAGAAATCCTGG - Intronic
1186547461 X:10465347-10465369 ATACCAGGGAGTTGGAATCCTGG - Intronic
1187139885 X:16583451-16583473 AAAGCAGGGACTGGGCTTCCAGG - Intergenic
1187863413 X:23702667-23702689 AAACCAGGCAATGTGGGTCCCGG - Exonic
1190626615 X:52343643-52343665 CCACCAGGGCTTGGGGTTCCAGG - Intergenic
1190701396 X:52992186-52992208 CCACCAGGGCTTGGGGTTCCAGG + Intronic
1195067538 X:101250967-101250989 ACACCATGGACTGGGGCTCCAGG - Exonic
1195494650 X:105516443-105516465 CATCCAGGTATTGGGTATCCAGG + Intronic
1195881068 X:109593177-109593199 GAATCAGGGATTGGAGGTCCAGG - Intergenic
1196203322 X:112910740-112910762 GAACCAGGGATGTGAGATCCTGG - Intergenic
1196603406 X:117627438-117627460 ATTCCAGTAATTGGGGATCCTGG - Intergenic
1196612951 X:117734666-117734688 TAACCAGGGAATGGGAATCCTGG - Intergenic
1196668249 X:118338683-118338705 ATACCAGGGGCTGGGAATCCTGG + Intergenic
1198140422 X:133797161-133797183 AAACCTTGGATTAGGAATCCAGG + Intronic
1198320892 X:135518164-135518186 ACACCAAGGATTGGAGATCATGG - Intergenic