ID: 1076678035

View in Genome Browser
Species Human (GRCh38)
Location 10:132158104-132158126
Sequence CTGAGTAGACAGATGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076678035 Original CRISPR CTGAGTAGACAGATGCTGCC GGG (reversed) Intronic
902464067 1:16603884-16603906 CAGAGTACACAGAGACTGCCAGG + Intronic
906270875 1:44477701-44477723 CTGAATAGACAGTAGCTACCTGG + Intronic
908175501 1:61551962-61551984 GTGGGTTGACAGATGCTGTCTGG + Intergenic
912102895 1:106233793-106233815 CTGTGATGAGAGATGCTGCCTGG - Intergenic
915909746 1:159907169-159907191 CTGAACAGACAGGTCCTGCCAGG + Intergenic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
920836187 1:209513237-209513259 CCAAGTAGTCAGTTGCTGCCAGG + Intergenic
921394204 1:214651181-214651203 CGGAGAAGACAAATGCTTCCAGG + Intronic
922794420 1:228333065-228333087 CTGAGTGGACAGAGACCGCCAGG - Intronic
1064110104 10:12531157-12531179 CTGTGAAGGCATATGCTGCCTGG - Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1067723028 10:48743889-48743911 CTGAGAAGACCGAGGCTGCCTGG - Intronic
1068419941 10:56778453-56778475 CTGAGTAGATTGAGGCTACCTGG - Intergenic
1070618699 10:77989542-77989564 CTGAATAAACAAATGCTGCCGGG + Intronic
1070939977 10:80335841-80335863 CTGAGAGGACAGTTGCTGGCTGG - Intergenic
1072083078 10:92052833-92052855 CTGCATTGTCAGATGCTGCCCGG - Intronic
1076199450 10:128546838-128546860 CTGAGTGGACAGGTGATGTCGGG - Intergenic
1076407899 10:130225562-130225584 CCGAGAAGACAGAAGGTGCCAGG - Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1078056404 11:8012638-8012660 GTGAGTAGAGAGATGATGCCGGG - Intergenic
1078136675 11:8657681-8657703 CTCAGTAGACTGGGGCTGCCCGG - Intronic
1079482144 11:20892614-20892636 CTGTGAAGACACATGCGGCCGGG + Intronic
1080103500 11:28486540-28486562 CTGTTTAGCCTGATGCTGCCAGG + Intergenic
1082861193 11:57858220-57858242 CTGAGGAGAAAGATGGAGCCTGG + Intergenic
1089327361 11:117666516-117666538 CTGAGGACAAAGCTGCTGCCGGG + Intronic
1089362017 11:117897157-117897179 CTGAGCAGTCAGAGTCTGCCAGG + Intergenic
1092132752 12:6124061-6124083 CTGAGATGTCAGATACTGCCAGG + Intronic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1101419935 12:104542667-104542689 ATGAGTAGACAGTTGTTGCCTGG + Intronic
1102721083 12:115016769-115016791 CTGAGTAGACATAGGCAGTCTGG + Intergenic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1103968117 12:124652944-124652966 CTGCAAAGACAGCTGCTGCCAGG - Intergenic
1106469018 13:30038438-30038460 CTGACTCTACTGATGCTGCCAGG + Intergenic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1119333941 14:73816697-73816719 TTGAGTACACAGATGGTGACTGG - Intergenic
1120222349 14:81748661-81748683 CTGAGCAGCTAGATGCTACCTGG + Intergenic
1121961565 14:98264924-98264946 CTGATTAGGTTGATGCTGCCTGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125828305 15:42693850-42693872 CTGAGTTGACTGATACTGCAGGG + Exonic
1127266126 15:57363659-57363681 CTGAGAAGTCAGATGTTGCATGG - Intergenic
1130062610 15:80580668-80580690 CTGAGTAGCCAGCTGCTGTTAGG - Intronic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136084685 16:27876560-27876582 CTAAGAAGCCACATGCTGCCTGG + Intronic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1139422847 16:66859575-66859597 CTGAGGAGACAGGGGCTCCCAGG + Intronic
1141986472 16:87583716-87583738 CTGAGTAGAAAGAGTCTGTCGGG + Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1143792424 17:9308198-9308220 CTGAGCAGACAGGTCCTGCGGGG - Intronic
1145914251 17:28561850-28561872 CTGAAGAGTTAGATGCTGCCTGG - Intronic
1148086462 17:44996530-44996552 CAGAGCAGGCAGCTGCTGCCTGG - Intergenic
1148435704 17:47682837-47682859 CTGAGGAGAAAGATGGAGCCTGG + Exonic
1148808969 17:50278580-50278602 CTGTGGTGACAGCTGCTGCCAGG + Exonic
1149205726 17:54244223-54244245 CTCAGGAGACAGATGCTGTGTGG + Intergenic
1149380359 17:56087427-56087449 CTGAGTAGAGAGACACTGCCCGG - Intergenic
1154105448 18:11518847-11518869 CACAGCAGAAAGATGCTGCCAGG - Intergenic
1155603594 18:27577227-27577249 CTTAGCACACAGTTGCTGCCCGG - Intergenic
1156010277 18:32489210-32489232 CCCATTAAACAGATGCTGCCTGG + Intergenic
1156345218 18:36251011-36251033 CTGAAGTGACAGATGCTGCAAGG - Intronic
1157946217 18:51983761-51983783 CAGAGTAGAAAAATGGTGCCAGG + Intergenic
1158130539 18:54148010-54148032 CTCAGTAGCAAGATGCTTCCAGG - Intergenic
1159988164 18:74870099-74870121 CTTAGTAGACTGAGGCAGCCTGG + Intronic
1161927992 19:7315669-7315691 CTGAGTTTACAGCTGCTGCCTGG - Intergenic
1163284035 19:16335241-16335263 CTGAGGCGACAGATGCCGGCTGG - Intergenic
1163433983 19:17284188-17284210 TTGAGCAGCCAGATCCTGCCAGG + Exonic
1163484530 19:17577985-17578007 CTGGGGATCCAGATGCTGCCTGG + Exonic
1163647301 19:18496676-18496698 CTGAGTGGACAGCAGCAGCCTGG - Intronic
1164393446 19:27844735-27844757 CTGGGTAGATAGCTGCTGCTAGG + Intergenic
1165647566 19:37455588-37455610 CTGCCTTGAGAGATGCTGCCAGG - Intronic
1202679726 1_KI270711v1_random:41324-41346 CAGAGTACACAGAGACTGCCAGG + Intergenic
925506580 2:4572396-4572418 CTGAGAAAGCAGATGCTTCCCGG - Intergenic
927004633 2:18835311-18835333 CTGAGCTGTCAGATGCTGGCAGG + Intergenic
927056375 2:19369229-19369251 CTGAGAAGATAAATGCTACCAGG - Intergenic
928179530 2:29058278-29058300 CTGTGTGCACAGATGCTCCCTGG + Exonic
929755260 2:44758908-44758930 CTGAGTAAACTCATGCTGTCTGG - Intronic
933000671 2:76918620-76918642 GTGATTACACAGATGCTTCCGGG - Intronic
938673117 2:133603898-133603920 CTCAGTAAACAGCTGCTGCCTGG - Intergenic
939820025 2:146946221-146946243 CTGAGTAGACAGATAGTATCTGG + Intergenic
940438298 2:153681597-153681619 CTGAGGAGAGAGATACTGACAGG - Intergenic
944078712 2:195760307-195760329 ATGAGTCCAGAGATGCTGCCTGG - Intronic
944353546 2:198758422-198758444 CTTAGAAGACATATGCGGCCGGG - Intergenic
948175846 2:235942171-235942193 CTGTGTAGACAGCTCATGCCAGG + Intronic
1169930980 20:10832743-10832765 CAGAGTAGACAGAGGCTTTCTGG + Intergenic
1170457629 20:16548189-16548211 ATGAGTAGACAGAGGCTGAGCGG - Intronic
1173026498 20:39312218-39312240 CTGAATGGACAGTGGCTGCCTGG - Intergenic
1174775528 20:53339884-53339906 CTGGGAAGTGAGATGCTGCCTGG - Intronic
1175491271 20:59382669-59382691 CTGTGTAGACAGATGCCCACAGG - Intergenic
1176951940 21:15058113-15058135 CTTATTCAACAGATGCTGCCGGG + Intronic
1176969813 21:15252576-15252598 CTGAGCAGAAAGATACTCCCAGG - Intergenic
1178269883 21:31179723-31179745 CTGTGTATACAGTTGCTGTCTGG - Intronic
1179108463 21:38424599-38424621 CAGAGTAGACAGATGCTGTGGGG + Intronic
1179580176 21:42338520-42338542 CAGAGGAGACAGAGGCTGTCAGG + Intergenic
1181995563 22:26878907-26878929 CTGAATAAGCAGATGCTCCCGGG + Intergenic
1182036855 22:27205668-27205690 CTGAGAAGACAAATGCTGCTGGG - Intergenic
1182101570 22:27661468-27661490 CTAAGAAGCCAGATGCCGCCAGG + Intergenic
1184738802 22:46415083-46415105 CAGAGCAGACAGATGTTGCCAGG + Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185212201 22:49576642-49576664 CTGTGTAGACAGACGTGGCCGGG - Intronic
949552040 3:5119692-5119714 CTGACTAAACAGATCCTTCCTGG + Intergenic
949630348 3:5919503-5919525 CTGACTAAACAGATCCTTCCTGG - Intergenic
950113762 3:10437394-10437416 CTGAGTAAACAGATTCTGAGAGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953795891 3:45985629-45985651 CTGGGTGTGCAGATGCTGCCTGG + Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
958535029 3:95389845-95389867 CTGAGTACTGAGATGCTGGCTGG - Intergenic
960000964 3:112731466-112731488 CTGAGCAGACAGGTCTTGCCGGG - Intergenic
963897747 3:150704282-150704304 TTGAGTAGACAGATGCTTGCTGG + Intergenic
965706012 3:171508832-171508854 CTGACTTGACAGTTGCTGCAGGG - Intergenic
966016813 3:175150073-175150095 TTGAGAAAACATATGCTGCCAGG - Intronic
966077198 3:175951573-175951595 CTGAGTAGCCAGATGAGACCAGG - Intergenic
966356311 3:179083030-179083052 GTGAGGACTCAGATGCTGCCTGG + Intergenic
971539935 4:27803369-27803391 CTGAGAAGCTAGATGCAGCCAGG - Intergenic
978220336 4:106265209-106265231 CTTAGTAGACAGATGATAACTGG + Intronic
980699965 4:136412832-136412854 CTCATTAGACAGATGTTTCCTGG - Intergenic
981632881 4:146841793-146841815 CTGAGCTGACTGATGGTGCCAGG + Intronic
981822620 4:148903402-148903424 CTCACTAGAAAGATGCTGGCAGG - Intergenic
982097093 4:151933209-151933231 CTGAGGAGCCAGAACCTGCCTGG - Intergenic
982219655 4:153113694-153113716 GTGAAGAGAGAGATGCTGCCGGG - Intergenic
982692124 4:158560613-158560635 CTGAGTAGCCTGATGATTCCCGG + Intronic
984329057 4:178291812-178291834 CTGAGTAGACAGTTTCAGCCAGG - Intergenic
984849419 4:184141204-184141226 CTGATTAGACAGCTGCCTCCTGG - Intronic
986318614 5:6609364-6609386 CTGGCTAGAAAGATGCAGCCCGG - Intronic
997522187 5:134530048-134530070 CAGAGTAGAGGGCTGCTGCCTGG - Intronic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001871010 5:175155867-175155889 CTGAGTAGAAAGAAACTGCAGGG - Intergenic
1002560697 5:180080041-180080063 CTGAGCAGTCACAGGCTGCCAGG + Intergenic
1004453911 6:15773572-15773594 TTGATTAGACAGATTATGCCAGG - Intergenic
1005247520 6:23905228-23905250 CTGAGTAGAAACAGGCTGCGAGG - Intergenic
1005872651 6:29986536-29986558 CTGAGGAGCCAGGTGCTTCCTGG + Intergenic
1006033433 6:31194303-31194325 CTGAGGAGCCAGATGCTTCCTGG - Intergenic
1006453140 6:34116955-34116977 CTGTGTAGACTGGTGTTGCCTGG - Intronic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007629940 6:43267817-43267839 CTGAGTACACAGACACTGCCCGG + Intronic
1007633716 6:43285974-43285996 CTGAGTAGACCGATGTTCCCTGG - Exonic
1008323492 6:50147727-50147749 CAGAGTAAACATATTCTGCCTGG - Intergenic
1012078864 6:94729458-94729480 CTGTGTAGACATGTGCTTCCTGG - Intergenic
1014258042 6:119183865-119183887 TTGAGAAGGAAGATGCTGCCTGG - Intronic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1018866356 6:167749473-167749495 CTGTGTACACAGATGCTCTCTGG - Intergenic
1019078494 6:169411289-169411311 CTGAGTAGACATCTGCTTCCAGG - Intergenic
1021179894 7:17494344-17494366 CTGAGTAGACGAATGCTACCAGG + Intergenic
1021912864 7:25403762-25403784 GTAAGTAGGCAAATGCTGCCTGG - Intergenic
1022122902 7:27326952-27326974 CTGATTAAAAAGATGCTCCCAGG - Intergenic
1024775608 7:52781905-52781927 CTCAGTAGAGAGCAGCTGCCTGG - Intergenic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1025130929 7:56373936-56373958 CTGAGCCGAGAGATGCAGCCAGG - Intergenic
1031778968 7:125939147-125939169 CTGTGATGAGAGATGCTGCCAGG - Intergenic
1034206582 7:149321339-149321361 CTGAGGAGAAAGATGGAGCCTGG - Intergenic
1034532315 7:151703659-151703681 CTGAGGAGGCAGGTGGTGCCTGG - Intronic
1035022446 7:155807548-155807570 CTGACTAGGCAGATGCAGACGGG + Intronic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1035272398 7:157728128-157728150 CTGGGCAGACACATGCAGCCCGG + Intronic
1038940742 8:32301950-32301972 CTGAATACAAAGATGCTGACTGG + Intronic
1039417218 8:37406071-37406093 CTGAATTGACAGCTTCTGCCGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1048189886 8:132278388-132278410 CTGCGTCGACACATGCTTCCTGG + Intronic
1049923571 9:387648-387670 CTCACTAGACATATGGTGCCTGG - Intronic
1050367051 9:4882274-4882296 CTGGGCAGAAAGAAGCTGCCAGG - Intronic
1050911808 9:11080793-11080815 ATAAGTATACAGATGTTGCCAGG - Intergenic
1060442984 9:123658919-123658941 CTGAGCATTGAGATGCTGCCTGG - Intronic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061856656 9:133445302-133445324 CTGTGCAGAGAAATGCTGCCAGG + Intronic
1062127347 9:134870731-134870753 CTGAGTCGTCAGATGCTCCCAGG + Intergenic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1062500971 9:136851874-136851896 CTGAGCAGCCAGGTGCTGTCCGG - Intronic
1189279890 X:39813621-39813643 CTGAGTAGATGGATGTTGCATGG + Intergenic
1192320672 X:70088001-70088023 CTTAGTAAACATATGCTGCCAGG - Intergenic
1194960415 X:100228796-100228818 CTGAGGAGACACATGCTGTGAGG - Intergenic
1201235222 Y:11903063-11903085 CTGAGTAGGCAAATGATGCATGG - Intergenic