ID: 1076680806

View in Genome Browser
Species Human (GRCh38)
Location 10:132170280-132170302
Sequence CCCCGAGGGCGGCTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076680792_1076680806 10 Left 1076680792 10:132170247-132170269 CCAGAGGTCGGGAGCTCCACAGC 0: 1
1: 0
2: 24
3: 849
4: 15117
Right 1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG 0: 1
1: 1
2: 2
3: 23
4: 273
1076680795_1076680806 -6 Left 1076680795 10:132170263-132170285 CCACAGCCTCCAGGGTCCCCCGA 0: 1
1: 0
2: 28
3: 39
4: 492
Right 1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG 0: 1
1: 1
2: 2
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076680806 Original CRISPR CCCCGAGGGCGGCTGGGGAC AGG Intronic
900095901 1:940024-940046 CCAGGCGGGCGGCTGGGGCCTGG - Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900188336 1:1343168-1343190 AACCGAGGGCAGCTGGGCACGGG - Intronic
900349407 1:2227690-2227712 CGCCGAGGGCCGCTGGGCGCGGG - Intergenic
900429854 1:2596382-2596404 CCCAGTGGCCGGCTGGGGTCAGG + Intronic
900524219 1:3120611-3120633 CCCAGGGGGCTGCCGGGGACAGG - Intronic
900600618 1:3501282-3501304 TCCCGAGGGCCGCTGGGGGCTGG - Exonic
900641556 1:3690211-3690233 CCCCGAGGGAGACAGGTGACGGG - Intronic
900739871 1:4324244-4324266 CCCAGAGGATGCCTGGGGACCGG + Intergenic
902005131 1:13225907-13225929 CCCAGAGGGAGGCAGGGGAAGGG + Intergenic
902024356 1:13371701-13371723 CCCAGAGGGAGGCAGGGGAAGGG + Intergenic
902304733 1:15527102-15527124 CTCGGAGGGCGGCGGGGGAGGGG + Intronic
902394544 1:16125395-16125417 CTCGGTGGGCGGCTGGGGAGGGG + Intronic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903349921 1:22711209-22711231 CCCCGCGGGCGCCCGGGGAGCGG + Intronic
903749911 1:25615384-25615406 CCCTGAGGCCTGCTGGGGATGGG - Intergenic
904618194 1:31761028-31761050 CCGCGCGGGCGGCGGGGGAGGGG + Intronic
904939994 1:34158997-34159019 TCCCAAGGGCAGCTGGGGGCTGG - Intronic
905793455 1:40802446-40802468 CCCCGAGAGCGGGAGGGGCCGGG - Intronic
906191098 1:43899998-43900020 CCCCTGGGGCTGCTGGGGTCTGG - Intronic
907518250 1:55006999-55007021 TACATAGGGCGGCTGGGGACTGG - Exonic
908951691 1:69568724-69568746 CCCAGAGGCCGGCCGGGGGCGGG + Intronic
910292861 1:85616166-85616188 ACCTGAGGGCGGCTCGGGTCAGG + Intergenic
912520441 1:110241031-110241053 CTCCCAGGGCGCCTGGGGGCGGG + Intronic
913323440 1:117606290-117606312 ACCCGAGGGGAGCTGCGGACAGG + Intronic
914456408 1:147841139-147841161 CCCAGAGGGAGGCGGGGGAAGGG - Intergenic
915125148 1:153658693-153658715 CCGCGAGGGCCGCCGGGAACCGG - Exonic
915313702 1:155016945-155016967 CCCCAGGAGCAGCTGGGGACAGG - Exonic
915593618 1:156884173-156884195 CCCCGTGGGGGGCTGGGACCAGG + Intergenic
919796332 1:201323452-201323474 CCAGGAGGCCAGCTGGGGACCGG - Intronic
919830912 1:201539468-201539490 GCCCGAGGGAGGCTGTGGGCTGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
920215994 1:204361865-204361887 CCCAGAGGGAGGCCGGGGAGGGG + Intronic
920541842 1:206784660-206784682 CCCCGGGGGCGGCGGGGGTGTGG + Intergenic
920943006 1:210501628-210501650 CCCCAGGAGCAGCTGGGGACAGG - Intronic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
922539603 1:226408659-226408681 CCCTGAGGGCAGCTGGGTCCGGG + Intergenic
922721710 1:227903186-227903208 CCCGGATGGTGGCTGGAGACGGG + Intergenic
923623334 1:235595098-235595120 CCCCGAGGGCTGCTGGGCCTTGG - Intronic
1062799960 10:371640-371662 ACCCGAGGGAGGCTGGGGTGAGG + Intronic
1062799972 10:371683-371705 ACCCGAGGGAGGCTGGGGTGAGG + Intronic
1062799982 10:371726-371748 ACCCGAGGGAGGCTGCGGTCAGG + Intronic
1062902392 10:1156203-1156225 GCCTGAGGGTGGCTGGGGTCAGG - Intergenic
1063450178 10:6145509-6145531 CCCGGAGGGCGGCGGGGCCCGGG + Intronic
1065485083 10:26229481-26229503 CCCAGAGGGCACATGGGGACAGG - Intronic
1067957265 10:50806098-50806120 CCCCATGGGCTGCAGGGGACAGG + Exonic
1069906725 10:71736403-71736425 CGGCCAGGGCTGCTGGGGACAGG - Intronic
1071856390 10:89629242-89629264 CCCCGAAGGCAGCTGAGCACTGG - Intronic
1073136951 10:101225484-101225506 CCCCAAGGCCGGCTGGGGCGGGG - Intergenic
1073202767 10:101749660-101749682 CCTGGAGCGCGGCTGGGGACTGG - Intergenic
1076499286 10:130923698-130923720 CCCCAAGGGTGGATGGGGAAGGG - Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076738217 10:132468128-132468150 CTCCCAGGGCGGGAGGGGACGGG + Intergenic
1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG + Intronic
1077012954 11:387195-387217 CCTCATGGGAGGCTGGGGACTGG - Intergenic
1077014628 11:394129-394151 CCCTGAGCGCAGCTGGGGGCGGG - Intronic
1077145457 11:1042363-1042385 CTCCGAGGGTGGCTGGTGAGGGG + Intergenic
1077173600 11:1179027-1179049 CCCCGCGGGCTCTTGGGGACCGG - Intronic
1077364870 11:2157566-2157588 CCGCCAGGGCATCTGGGGACCGG + Intronic
1077412460 11:2410043-2410065 CCCCGAGGGGCCCTGCGGACGGG + Intronic
1077430953 11:2515799-2515821 GGCCGAGGGCTGCTGGGAACGGG - Intronic
1077500961 11:2909567-2909589 CCATCTGGGCGGCTGGGGACGGG - Exonic
1083728045 11:64638463-64638485 TCCGGAGCGCGGCTGGGGAGGGG - Intronic
1084192438 11:67505140-67505162 CCAAGAGCGCGGCAGGGGACCGG - Intronic
1088875868 11:113935804-113935826 CCCAGCGGGAGGTTGGGGACGGG + Intronic
1089341830 11:117763341-117763363 CCCAGTGGGCAGCTGGGGTCCGG + Intronic
1089341890 11:117763683-117763705 CCCAGTGGGCAGCTGGGGTCCGG - Intronic
1089750663 11:120648983-120649005 CCCCGAGGGAGCCTGGTGCCAGG + Intronic
1091588110 12:1827568-1827590 GCCCGAGGGAGGCAGGGGCCAGG - Exonic
1094842605 12:34348374-34348396 CCCCCAGAGCGGCTGGGCCCCGG - Intergenic
1095042282 12:37455879-37455901 GTCCGAGGGTGGCTGGGCACTGG + Intergenic
1095982006 12:47979335-47979357 CCCTGAGGGTGGCTGGGGGCAGG - Intronic
1096418623 12:51436156-51436178 CTCCCAGTGCGGCTGAGGACTGG - Intronic
1096782197 12:53997903-53997925 AGCCCAGGGCGGCTGAGGACCGG - Intronic
1097195561 12:57240806-57240828 CCCAGATGGGAGCTGGGGACGGG + Intergenic
1097675958 12:62602997-62603019 CCCCGAAGGGTGCTGGGGAACGG + Exonic
1100613167 12:96208971-96208993 CCCCAAGGGATCCTGGGGACCGG - Intronic
1102240175 12:111320292-111320314 GCACGAAGGCGGCGGGGGACAGG - Exonic
1102467429 12:113138047-113138069 CCCCGTGGGGAGCTGGGGAAGGG - Intergenic
1103097994 12:118147443-118147465 CCCCAAGGGCGGCTAGGAAGGGG + Intergenic
1103700234 12:122845444-122845466 CCGCGCTGGCGGCAGGGGACAGG - Intronic
1103786417 12:123436427-123436449 CTCCGAGGTCGGCGGGGGTCTGG - Exonic
1103856408 12:123973392-123973414 CCCGGAGGGAGGCGGGGGCCGGG + Exonic
1103903726 12:124316640-124316662 CCCCAGAGGCTGCTGGGGACAGG + Intergenic
1104801432 12:131557416-131557438 TCCTGAGCGCGGCTGGAGACAGG + Intergenic
1112415530 13:99200866-99200888 CCCAGAGGGCGCCGGGGGAGGGG - Exonic
1113025580 13:105937624-105937646 CCCTGAGGGCAGCTGAGCACAGG + Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1114075650 14:19159820-19159842 CCCAGAGTTCAGCTGGGGACTGG + Intergenic
1114086511 14:19239752-19239774 CCCAGAGTTCAGCTGGGGACTGG - Intergenic
1115664468 14:35533419-35533441 GCCCGAGCGCGGCTGGGTCCTGG - Intergenic
1119436439 14:74600621-74600643 CCCCTGGGGCAGCTGGGGAAAGG + Intronic
1122296160 14:100706755-100706777 CACAGAGGGCGGCTGGGTCCCGG + Intergenic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122604332 14:102938271-102938293 CCCCCAGGGCTGCGGGGGCCAGG + Intronic
1122801193 14:104230472-104230494 CCCCAAGTCCGGCTGGTGACAGG + Intergenic
1122822963 14:104356279-104356301 GCCCAGGGGCGGGTGGGGACAGG - Intergenic
1123125836 14:105945364-105945386 CCCAGAGGGCTGCTGGGTCCAGG + Intergenic
1124619181 15:31264464-31264486 TCCAGGGGGCGGCAGGGGACCGG + Intergenic
1124619795 15:31267175-31267197 CCCCAAGGGCGTCTAGGGCCGGG + Intergenic
1124955284 15:34356209-34356231 CCCCTAGAGCAGCTGGGGAGAGG + Exonic
1126850701 15:52795219-52795241 ACCCGAGGGCGGCTGAGGACTGG + Intergenic
1127961168 15:63891978-63892000 CCCCGAGGGAGGGCAGGGACTGG - Intergenic
1132405462 15:101539631-101539653 CCCGGAGGGCAGCAGGGCACAGG - Intergenic
1133020547 16:2964992-2965014 CCCCCACGGCCGCTGGGGGCTGG + Exonic
1133732617 16:8589903-8589925 CGCGGTGGCCGGCTGGGGACGGG - Intergenic
1134022299 16:10929608-10929630 CCACCAGGTTGGCTGGGGACAGG + Exonic
1134529972 16:14975362-14975384 CCGGGAGGGCGGCTGGGGCCCGG + Intronic
1135128204 16:19829234-19829256 CACTGAGGGAGGATGGGGACAGG - Intronic
1136403691 16:30031357-30031379 CACAGGGGGCTGCTGGGGACAGG + Intronic
1137722142 16:50633541-50633563 GCCCGAGGGGGGCTAGGGAGGGG - Exonic
1138337808 16:56266945-56266967 ACACGGTGGCGGCTGGGGACTGG - Intronic
1139805881 16:69565589-69565611 CCCAGAGGCCGGCGGCGGACGGG - Intronic
1139866375 16:70065592-70065614 CCGGGAGGGCGGCTGGGGCCCGG - Intergenic
1141424091 16:83934404-83934426 CCCCGAGGGGGGCTGGGGCTGGG - Intronic
1141579768 16:84989203-84989225 ACCAGAGGGCAGCTGGGGAGTGG - Intronic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1142262763 16:89050477-89050499 CCACGATGGAGACTGGGGACCGG - Intergenic
1142304415 16:89277642-89277664 CCCCGGGGACGGCTGGGGTCAGG + Intronic
1143450956 17:7036403-7036425 CCCCGACGGGGGCTGGGGATGGG + Exonic
1144519814 17:15945907-15945929 CCCCGTGGGCGGGTGGAGCCCGG + Intronic
1144909964 17:18672710-18672732 CGACGAGGACGGCGGGGGACGGG - Intronic
1145975080 17:28979175-28979197 AACCCAGGGAGGCTGGGGACAGG + Intronic
1145980116 17:29006063-29006085 CGCCGAGCGGGGCTGGGGGCGGG + Exonic
1146229302 17:31094652-31094674 CCCGGAGGCCGGCGGGGGAGGGG + Intergenic
1146668034 17:34717650-34717672 CCCCTGGGGCGGGAGGGGACAGG - Intergenic
1146902100 17:36595250-36595272 ACCAGAGTGCTGCTGGGGACGGG + Intronic
1147145453 17:38482088-38482110 CTCCGAGGGCGTTTGGGGTCAGG + Exonic
1147591133 17:41684027-41684049 CTCCGAGAGCAGCAGGGGACAGG - Intergenic
1147612864 17:41811955-41811977 CCCCGCGGACGGAAGGGGACAGG + Exonic
1148329785 17:46806876-46806898 TCACGATGGCTGCTGGGGACGGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1151215325 17:72573113-72573135 CATCGAGGGCAGCAGGGGACAGG - Intergenic
1152295488 17:79464783-79464805 CCCCGAGGACAGCTGAGAACAGG + Intronic
1152632149 17:81415097-81415119 CTGCGCGGGGGGCTGGGGACGGG + Intronic
1152783345 17:82236053-82236075 CCCTGACGGCGGCTGGGGCTGGG + Exonic
1153676476 18:7460135-7460157 CCCCACGGGCTGCTGGGGCCTGG - Intergenic
1153779320 18:8479989-8480011 CCCCGAGGGAGCTTTGGGACCGG - Intergenic
1154329492 18:13418106-13418128 CTCAGAGGGCGGGTGGGGAGCGG - Intronic
1155164114 18:23218860-23218882 CCCTGATGGAGGCTGGGGAAGGG + Intronic
1157384124 18:47247702-47247724 CGCCGAGGGCGGCTGAGGCGGGG + Intronic
1157794051 18:50559482-50559504 ATCCCAGGCCGGCTGGGGACCGG + Intergenic
1160597684 18:79988473-79988495 GCCCGGGGGCGGCGGGGGCCGGG - Exonic
1160775349 19:852810-852832 CCCCGTGGCCGGGAGGGGACAGG + Intronic
1160788251 19:911918-911940 CCCAGAGGGCGAGTGGGGCCGGG + Intronic
1160977917 19:1802807-1802829 CCCTGAGGCCAGGTGGGGACAGG - Intronic
1161029813 19:2052308-2052330 CCCCGGGGGTGGCTGAGGCCAGG - Intergenic
1161039140 19:2100748-2100770 CCCCGGGGGCTCCTGGGGAAGGG + Intergenic
1161064920 19:2232893-2232915 CCCGGAGTGTGGCTGGGGCCTGG - Intronic
1161153715 19:2721749-2721771 CCCTGAGGCCGGCTGGGGCCCGG + Intronic
1161219204 19:3110338-3110360 GCCCGCGGGCGCCTGGGGAGGGG + Intronic
1162437709 19:10672297-10672319 CACTGTGGGAGGCTGGGGACAGG - Intronic
1162502224 19:11060407-11060429 ACCCGTGGGTGTCTGGGGACTGG + Intronic
1162798406 19:13098267-13098289 CCCCGAGGGTGGGTGGGGTGGGG - Intronic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1164432062 19:28197341-28197363 GCCTGAGGGCTGCTGGGGAGGGG - Intergenic
1165101108 19:33439281-33439303 CCCAGAGGGAGGCAGGGGGCAGG - Intronic
1165139425 19:33689930-33689952 CACAGAGGGCTGCTGGGAACAGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165446999 19:35861876-35861898 CCCAGAGAGCCGCGGGGGACTGG + Exonic
1165862277 19:38915580-38915602 CCCCGAGGGCTGCTGTGGGTGGG + Exonic
1165928720 19:39342760-39342782 CCAGGAGGGAGACTGGGGACGGG - Intronic
1166303047 19:41922869-41922891 CCCGGTGTGGGGCTGGGGACAGG - Intronic
1166361324 19:42254037-42254059 GCCCGGGGGCGGCGGGGGAGGGG + Intronic
1166980924 19:46631640-46631662 CCCCGGGGGAGACGGGGGACAGG - Intergenic
1167513938 19:49911867-49911889 CCCCCAGGACTGCTGGGGCCTGG + Intronic
925209416 2:2033793-2033815 CCCCAACGGCCCCTGGGGACAGG + Intronic
926686747 2:15704097-15704119 TCCCCAGGGAGGCTGGGGAGGGG + Intronic
927103721 2:19807127-19807149 CCCGGAGAGCGGGTGGGGAAGGG - Intergenic
927513572 2:23659233-23659255 CCCCCAGCGCCGCTGCGGACGGG - Intronic
927542544 2:23926433-23926455 CCGCTCGGGCGGCTGGAGACAGG - Intronic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
932025744 2:68130764-68130786 CCCCGAGAGAGGCTGGAGGCTGG + Exonic
932620891 2:73264493-73264515 CCCCGAGGGAGGCAGTGGGCGGG - Exonic
933923868 2:87075568-87075590 TCCCGGGGCCGGCTGGGGGCGGG + Intergenic
937036886 2:118789444-118789466 CCCCGAGTGCTGCAGGGGAGAGG - Intergenic
938490241 2:131757320-131757342 CCCAGAGTTCAGCTGGGGACTGG + Intronic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946328332 2:218996380-218996402 CACCGAGCGGGGCTGGGGGCTGG + Intergenic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
947879100 2:233489426-233489448 CTCTGAGGTGGGCTGGGGACGGG + Exonic
948087627 2:235264739-235264761 CCCGTAGGGCCGCTGGGCACTGG + Intergenic
948560658 2:238849082-238849104 TCCTGGGGCCGGCTGGGGACTGG + Intronic
1171090690 20:22283451-22283473 CCCTAAGGATGGCTGGGGACCGG + Intergenic
1171839655 20:30194216-30194238 GTCCGAGGGTGGCTGGGCACTGG + Intergenic
1174340664 20:49893074-49893096 CTGCGAGGGCGGCTGGGAAGTGG + Intergenic
1174436496 20:50510656-50510678 CCCAGAGGGAGTCTGGGGCCTGG - Intronic
1175418634 20:58817505-58817527 CCCCTGGGGCGGCCGGGCACTGG - Intergenic
1175831447 20:61967165-61967187 CCCAGAGGGCTGCTGGTGAGGGG + Intronic
1175902802 20:62366706-62366728 ACCCGGGGGCGGCTGGGCGCCGG - Intronic
1176097954 20:63352894-63352916 CCCAGAGGGCGGCTGGAGCCAGG - Intronic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1179830752 21:43994529-43994551 CCTCGGGGGCGGGTGTGGACAGG - Intergenic
1179885980 21:44314445-44314467 CCCTGAGGGCGGTCGGGGCCCGG + Intronic
1180291352 22:10852986-10853008 CCCAGAGTTCAGCTGGGGACTGG + Intergenic
1180494157 22:15882408-15882430 CCCAGAGTTCAGCTGGGGACTGG + Intergenic
1181057564 22:20267406-20267428 CCACGAGGGCTGCTAGGGAGGGG + Intronic
1181273312 22:21673412-21673434 CCATGAGGGCAGCTGTGGACAGG - Intronic
1182430029 22:30293870-30293892 CACTGTGGGCTGCTGGGGACAGG + Intronic
1182926476 22:34129983-34130005 CCCAGATGGTGGCTGGGGACAGG - Intergenic
1183260326 22:36790667-36790689 CCCTGAGGGAGGCTGGGGCCAGG + Intergenic
1183329508 22:37211895-37211917 CCCTGGGGGCACCTGGGGACTGG - Exonic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1183484736 22:38082816-38082838 CCCAGACGGCGGCTGGGGCTGGG - Exonic
1183605147 22:38863700-38863722 CCCTGGGGGTGGCTGGGGAGAGG - Exonic
1185051698 22:48557448-48557470 CCCTGAGCGATGCTGGGGACAGG + Intronic
1185222427 22:49635852-49635874 TCCGGAGGGAGCCTGGGGACGGG + Intronic
950446020 3:13039116-13039138 CCCTGAGGTCGGCTGGGCTCTGG + Intronic
953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG + Intergenic
954152108 3:48662761-48662783 CCCAGAGGGCGGCGGGGGTGCGG - Exonic
954379855 3:50213602-50213624 CCCGCCGGGCGGCTGGGAACAGG + Intronic
954675897 3:52315253-52315275 CCAAGAGGGAGGCTGGGGACAGG + Intergenic
956728574 3:72176889-72176911 GGCTGAGGGCAGCTGGGGACTGG + Intergenic
961831824 3:129626980-129627002 CCCCTAGGCCGGCTGGGAGCTGG - Intergenic
964479935 3:157130280-157130302 CCCCGAGGGAGGCTGGGGTAGGG + Intergenic
966861064 3:184230993-184231015 CCCGGAGGAAGGCGGGGGACGGG - Intronic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
968562293 4:1290345-1290367 CCGGGAGGGCGGCCGGGCACTGG - Intronic
968616359 4:1579343-1579365 GCCCGAGGGCGGCCGGGGTAGGG - Intergenic
969244446 4:5923455-5923477 TGGCGGGGGCGGCTGGGGACAGG + Intronic
969330431 4:6471282-6471304 CCCCGATGGAGGATGGGGACCGG - Intronic
969641623 4:8402189-8402211 CCCTGGGGCCGGGTGGGGACGGG + Intronic
969716553 4:8870945-8870967 GTCCCAGGGAGGCTGGGGACAGG - Intronic
971457927 4:26861282-26861304 CTCCGCGGGCGGCGGGCGACTGG + Exonic
972321574 4:37977415-37977437 GCCCGCGGGCGGCCGGGGGCGGG - Intronic
972621301 4:40750279-40750301 CCCCGAGGGCGGATGGTTCCCGG - Exonic
976389253 4:84492914-84492936 CCCCGCGGGCGGCGGGGTAGGGG - Exonic
982746116 4:159104604-159104626 CACGGAGGGCGGCTGGGGAGAGG - Intronic
984704319 4:182836701-182836723 CCGCGAGGGCCTGTGGGGACGGG - Intergenic
984778559 4:183504789-183504811 CACGGAGGGTGACTGGGGACAGG + Intergenic
985579381 5:688956-688978 CCCCGGGGCTGGCTGGGGCCTGG + Intronic
985594227 5:781015-781037 CCCCGGGGCTGGCTGGGGCCTGG + Intergenic
985774080 5:1831634-1831656 CCCAGAGGGGGCCTGGGGCCTGG + Intergenic
989744334 5:44809544-44809566 CACCGAGGGCGGCAGCGGCCAGG - Exonic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
998586379 5:143431749-143431771 CCCCTAGGGTGGCTGTGTACAGG - Intronic
999250068 5:150177159-150177181 CCCGGGGGGAGGATGGGGACAGG - Intronic
999254924 5:150204906-150204928 CCAAGAGCGTGGCTGGGGACAGG - Exonic
1002428110 5:179187597-179187619 CCCCCAGGGCTGCTGGGGGGAGG - Intronic
1002638326 5:180618977-180618999 CGCCGCGGGCGGCGGGGGAATGG - Intronic
1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG + Intergenic
1003544900 6:7051436-7051458 CCCCGAGGGCGGCTGCGGCGCGG + Intergenic
1004864491 6:19838692-19838714 CCCCGAGGGCTTCCGGGGCCAGG + Intronic
1004923863 6:20401524-20401546 CCCGGCGGGCGGGCGGGGACAGG + Intergenic
1005783213 6:29215708-29215730 ACCGGAGGGTGGCAGGGGACTGG - Intergenic
1005886414 6:30101062-30101084 CCTTCAGGCCGGCTGGGGACTGG - Intergenic
1011696923 6:89921324-89921346 CCCTTATGGGGGCTGGGGACAGG + Intergenic
1013273348 6:108561403-108561425 CGACGAGGACGGCGGGGGACGGG + Exonic
1013288172 6:108698277-108698299 CACCGAGGGCTGAGGGGGACAGG - Intergenic
1018469327 6:164082134-164082156 CCACGAGAGCTCCTGGGGACAGG - Intergenic
1018625127 6:165770847-165770869 CCCCGGGAGCACCTGGGGACAGG - Intronic
1019421414 7:952968-952990 CCCAGAGGGTGGCTGGAGAGGGG + Intronic
1019631972 7:2054187-2054209 ACCCATGGGCGGGTGGGGACAGG + Intronic
1019746570 7:2703543-2703565 CCCTGAGGGTCGCTGGTGACTGG + Intronic
1021905205 7:25326550-25326572 CCCAGTGGAGGGCTGGGGACGGG + Intergenic
1022105293 7:27192546-27192568 GGCTGAGGGCGGCTGGGGTCAGG - Intergenic
1024981582 7:55161533-55161555 CCCCGAGGGCTGCTGGGGCCCGG + Exonic
1026123972 7:67563220-67563242 CCCTGGGGGTGGCTGGGGACTGG + Intergenic
1026740663 7:72976477-72976499 CCCCGAGGAGGCCTGGGCACAGG - Intergenic
1027103069 7:75388594-75388616 CCCCGAGGAGGCCTGGGCACAGG + Intergenic
1027252770 7:76409614-76409636 CCCTAAGGTCGGATGGGGACAGG - Exonic
1027592697 7:80135300-80135322 CCCGGGGGTCGGCGGGGGACCGG + Intronic
1029742108 7:102496697-102496719 CCCAAGGGGTGGCTGGGGACGGG + Intronic
1029760097 7:102595862-102595884 CCCAAGGGGTGGCTGGGGACGGG + Intronic
1031919004 7:127588156-127588178 GCCCGAGCGCGGCTGAGGAAAGG - Intronic
1034400319 7:150857583-150857605 CCTCGATGTCGGCTGGGGCCTGG + Exonic
1034564763 7:151904354-151904376 CACCGATGGCTGCTGGGGGCAGG + Intergenic
1038038772 8:23706871-23706893 CCAGGAAGGCGACTGGGGACTGG - Intergenic
1039453719 8:37695284-37695306 CCCAGAGGCCGCCTGGGGGCAGG - Intergenic
1039903071 8:41766996-41767018 CCCCGAGGGGGGCCGGGCCCTGG - Intronic
1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG + Intergenic
1044728992 8:95215241-95215263 CCGCGAGGGCCCATGGGGACAGG - Intergenic
1045111547 8:98942056-98942078 CGCCGAGGGCTGCTGGGGGCGGG + Intronic
1049208233 8:141373224-141373246 CCCCGATGGCCCCTTGGGACAGG + Intergenic
1049611648 8:143558702-143558724 CCCAGAAGGCAGCTGGGGGCGGG - Intronic
1049654653 8:143792260-143792282 CCCGGAGCTCGGCAGGGGACAGG + Exonic
1050512956 9:6413663-6413685 CCCCTAGCGAGGCTGGGGGCCGG + Intronic
1053050562 9:34958072-34958094 CTCCGCGGGCGGCGGGTGACCGG - Intronic
1053644602 9:40113048-40113070 CCCAGAGTTCAGCTGGGGACTGG + Intergenic
1053761380 9:41351803-41351825 CCCAGAGTTCAGCTGGGGACTGG - Intergenic
1054325625 9:63710928-63710950 CCCAGAGTTCAGCTGGGGACTGG + Intergenic
1054350153 9:64013348-64013370 CCCAGAGTTCAGCTGGGGACTGG - Intergenic
1054539974 9:66262921-66262943 CCCAGAGTTCAGCTGGGGACTGG - Intergenic
1056732455 9:89178042-89178064 CCCCGAGGGGGCCTGGGCAGCGG + Exonic
1060183872 9:121552117-121552139 CCCAGAGGGTGGCTGGACACAGG + Intergenic
1060481540 9:124019031-124019053 CCCCCAGTGGAGCTGGGGACTGG + Intronic
1060550632 9:124483351-124483373 CCCCGAGGGAGGCTGGTGATGGG - Intronic
1061149416 9:128820429-128820451 CCCTGGGTGGGGCTGGGGACAGG + Exonic
1061262657 9:129488602-129488624 CCGCGAGGGCGGGAGGGGGCCGG - Intergenic
1061299845 9:129698111-129698133 CCCCGAAGCTGCCTGGGGACGGG - Intronic
1061825531 9:133256231-133256253 CCCCGCGTGACGCTGGGGACCGG - Exonic
1062230684 9:135479995-135480017 CGCGGCGGGCGGCGGGGGACGGG + Exonic
1062353168 9:136148947-136148969 CCCCCAGGGCAGCTGAGGCCAGG + Intergenic
1062584255 9:137241843-137241865 CCCGGAGGGCGGTCGGGGAAGGG - Intronic
1062617972 9:137406771-137406793 CCCAGAGGAGGGCTGGGGAGAGG - Intronic
1190261743 X:48801991-48802013 GACCGAAGGCGGCTAGGGACTGG + Exonic
1194733087 X:97479195-97479217 CCCCCAGGGTGGGTGGGGTCGGG - Intronic
1198254676 X:134914787-134914809 CACCGAGGACGGCTGGGGGAGGG - Intronic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic