ID: 1076681277

View in Genome Browser
Species Human (GRCh38)
Location 10:132172736-132172758
Sequence GGGTTATGGACCCCGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076681277_1076681288 8 Left 1076681277 10:132172736-132172758 CCACAAGGCGGGGTCCATAACCC No data
Right 1076681288 10:132172767-132172789 GGGAGCTCTGGCTTCTGTGTTGG No data
1076681277_1076681281 -4 Left 1076681277 10:132172736-132172758 CCACAAGGCGGGGTCCATAACCC No data
Right 1076681281 10:132172755-132172777 ACCCCTTCCCCAGGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076681277 Original CRISPR GGGTTATGGACCCCGCCTTG TGG (reversed) Intronic