ID: 1076682822

View in Genome Browser
Species Human (GRCh38)
Location 10:132183167-132183189
Sequence TAAAAGCTACCGTGGCGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076682822 Original CRISPR TAAAAGCTACCGTGGCGCTG TGG Exonic
900879024 1:5367197-5367219 TAAAAGGTATCTTGGCCCTGAGG + Intergenic
901904523 1:12396251-12396273 TCAAGGCTACTGTGGAGCTGGGG + Intronic
921960616 1:221029884-221029906 TAAAAACTACCATGGCTGTGGGG - Intergenic
922475549 1:225904978-225905000 TAAAAGCTAGCCAGGCGCGGTGG - Intronic
1065905717 10:30249281-30249303 TAAAAGCAACCGTCACGCAGTGG - Intergenic
1068253129 10:54470056-54470078 TAAACACTACCGGGGGGCTGAGG - Intronic
1072680466 10:97502417-97502439 TAAGAGTTACAGTGGCGCTGGGG - Intronic
1074351831 10:112745260-112745282 TAAAAGCTTCTTTGGCTCTGTGG + Intronic
1076682822 10:132183167-132183189 TAAAAGCTACCGTGGCGCTGTGG + Exonic
1094200081 12:27786314-27786336 TAAAGGCTGTCGTGGAGCTGAGG - Intronic
1094358087 12:29600239-29600261 TAAAATCCTCCGTGGCTCTGGGG + Intronic
1096146331 12:49281584-49281606 TAAAAATTACCCTGGTGCTGTGG + Intergenic
1098430168 12:70410376-70410398 TAAAAGCAACCATGGCAGTGTGG - Intronic
1102972005 12:117176223-117176245 TAAATGCTACTGTAGCTCTGAGG + Intronic
1103878632 12:124148895-124148917 TAAAAGCTTCAGTGGAGCAGTGG + Intronic
1105050538 12:133046256-133046278 TAAAGGCCACAGTGGGGCTGGGG - Intronic
1107067592 13:36232160-36232182 TCAAGGCTACCATGGAGCTGGGG - Intronic
1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG + Intronic
1115728709 14:36244880-36244902 TCAAGGCTACCGTGGAGCTGCGG - Intergenic
1119492955 14:75052304-75052326 TAAAAGCTGTGGTGGCACTGGGG - Intergenic
1119833114 14:77721530-77721552 TAAAAGTTACAATGGCTCTGTGG - Intronic
1121432460 14:93897753-93897775 GAAAAGCAAGCGTGGAGCTGTGG + Intergenic
1126337903 15:47606468-47606490 TAAAAGGTACTGTGGCTTTGTGG - Intronic
1131089845 15:89615411-89615433 TTAAAGCTACCGTAGGGCTAGGG + Intronic
1135904015 16:26493786-26493808 GAAAAGCTACTATGGCCCTGGGG - Intergenic
1140669542 16:77263579-77263601 TCAAGGCTACCGTGTTGCTGGGG + Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146080179 17:29772885-29772907 TAAAGGCTTCCCTGGCTCTGAGG + Intronic
1155760665 18:29561908-29561930 TCAAGGCTACCATGGAGCTGTGG - Intergenic
932268206 2:70386522-70386544 TAGAAGCTACAGTGGGGCTGGGG - Intergenic
938799069 2:134743479-134743501 TGAAAGCTACTGTGGCTGTGAGG + Intergenic
939126447 2:138183291-138183313 AAAAAGCTACCCTGGCTCAGAGG + Intergenic
940791584 2:158034932-158034954 TGCAAGCTACAGTGGCTCTGGGG - Intronic
1180160638 21:45997444-45997466 TAAAGGCTACCGAGGCGATGAGG + Exonic
1183942168 22:41302023-41302045 TAAAAGTTACCGTGTGGCCGGGG + Intronic
1185260544 22:49859539-49859561 TAAAAGGAACCCAGGCGCTGTGG - Intronic
952756195 3:36869932-36869954 TAAAACCTAAGGTGGGGCTGGGG - Intronic
953445240 3:42958435-42958457 TAAAAGTTACAGTAGGGCTGGGG - Intronic
956164594 3:66386914-66386936 TCAAGGCTACCATGGAGCTGGGG - Intronic
962659933 3:137591509-137591531 TCAAAGCTACCGCAGAGCTGGGG - Intergenic
968402863 4:313595-313617 CAAAAACTACCGTGGTGTTGTGG + Intergenic
968742240 4:2337165-2337187 GAAAAGCGACCGTGGGGCGGTGG + Intronic
979557603 4:122067300-122067322 TAAAAGCCAGCGTGGCAGTGTGG - Intergenic
996116492 5:119625828-119625850 TCCAAGCTACTGTGGGGCTGAGG - Intronic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
999101961 5:149032895-149032917 TAGAAGCTTCCGTGGTGTTGGGG - Intronic
1001630955 5:173175129-173175151 TAAAAGGCACAGTGGCGTTGAGG - Intergenic
1004463500 6:15861820-15861842 TAAAAGATACCATAGGGCTGAGG + Intergenic
1012243306 6:96898061-96898083 TAAAAGCAACCGTGGGTCTGGGG - Intergenic
1013643465 6:112111678-112111700 TAAAAGCTGCAGTGGTGCAGTGG + Intronic
1016347068 6:143125027-143125049 TAAAAGGTACCCTGGAGCTCAGG - Intronic
1026487934 7:70837142-70837164 GAAAAGCCACCGGGGCGGTGAGG + Intergenic
1034639430 7:152590903-152590925 TAAAATCACCCGTGGAGCTGAGG - Intergenic
1038296852 8:26300566-26300588 TAAAAGCTGGCGGGGCGCGGTGG + Intronic
1050532292 9:6601018-6601040 CAAAAACTAGCCTGGCGCTGTGG + Intronic
1057806485 9:98223332-98223354 AAAGAGCTACCATGGAGCTGTGG + Intronic
1061802591 9:133120585-133120607 TAAAGGCTAACGACGCGCTGCGG + Intronic
1062419241 9:136471593-136471615 GAAAAGCTGCCGTGTCTCTGGGG + Intronic
1189955332 X:46271878-46271900 TTAAGGCTACTGTGGAGCTGGGG - Intergenic
1192395009 X:70771827-70771849 TAGGAGCTAACTTGGCGCTGGGG - Intronic
1196051027 X:111304443-111304465 TCAAGGCTACCATGGAGCTGGGG - Intronic
1197467955 X:126829437-126829459 AAAATGCTACCGTGGTGCTTGGG - Intergenic
1198302991 X:135349638-135349660 TAAAAGCAACCGAGGCCCTTGGG - Intronic
1199536105 X:148905185-148905207 TAAATGCTACCCTGGTGCTCTGG - Intronic