ID: 1076685728

View in Genome Browser
Species Human (GRCh38)
Location 10:132197702-132197724
Sequence GTCCCACGAAGTCTCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076685728_1076685741 22 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685741 10:132197747-132197769 TGAGCTCTACAGGAAGGTGGTGG No data
1076685728_1076685742 29 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685742 10:132197754-132197776 TACAGGAAGGTGGTGGCACTCGG No data
1076685728_1076685737 16 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685737 10:132197741-132197763 ACCTCCTGAGCTCTACAGGAAGG No data
1076685728_1076685739 19 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685739 10:132197744-132197766 TCCTGAGCTCTACAGGAAGGTGG No data
1076685728_1076685734 12 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685734 10:132197737-132197759 GCCCACCTCCTGAGCTCTACAGG No data
1076685728_1076685743 30 Left 1076685728 10:132197702-132197724 CCCACAGTGAGACTTCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1076685743 10:132197755-132197777 ACAGGAAGGTGGTGGCACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076685728 Original CRISPR GTCCCACGAAGTCTCACTGT GGG (reversed) Intronic
901436215 1:9248814-9248836 GACCCATGAAGGCTCACTGCAGG - Intronic
901499957 1:9646070-9646092 GTCCTAAGAAGTTTCACTTTCGG - Intergenic
903307194 1:22421223-22421245 GTCCCACGAAATCAAACTGTTGG + Intergenic
909085669 1:71167518-71167540 TTCCCACCAATTCTCACTCTTGG + Intergenic
916347809 1:163813975-163813997 TTCCCACTTAGTCCCACTGTTGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
1065282394 10:24153124-24153146 TTACCATGAAGTCTGACTGTGGG + Intronic
1067151336 10:43737366-43737388 GTTCCACCCAGTCCCACTGTAGG + Intergenic
1073799903 10:107029990-107030012 GTCCCTCCAAGGCTCACTTTAGG - Intronic
1076685728 10:132197702-132197724 GTCCCACGAAGTCTCACTGTGGG - Intronic
1077776055 11:5272719-5272741 GTCCCAGGAAGTCTTAATCTGGG - Intronic
1083175438 11:60946894-60946916 GACCCAAGAAGTGTCTCTGTAGG - Intronic
1095698023 12:45162692-45162714 CTCCCACTAAGTCTCTTTGTAGG + Intergenic
1098309999 12:69139033-69139055 TTCCCAGGCATTCTCACTGTAGG - Intergenic
1102241639 12:111328219-111328241 GTCCCACAGAGTCTGGCTGTGGG + Intronic
1106888590 13:34217448-34217470 GTCCCAAGAGGACTCACGGTAGG - Intergenic
1107665359 13:42683268-42683290 GTCCAAAGAATTCTCACTGTGGG + Intergenic
1110841798 13:80152265-80152287 TGCCCACGGAGTCTCACTGATGG + Intergenic
1112204059 13:97306587-97306609 GTCCCAGGCAGTCACACTGGTGG - Intronic
1113959983 13:114120679-114120701 GTCACACGGAGTTTCTCTGTGGG - Intronic
1123069748 14:105636698-105636720 GTCACACCATGTCACACTGTGGG + Intergenic
1127621022 15:60734594-60734616 GTCCCAAGAAATCTAACAGTGGG - Intronic
1129003284 15:72351617-72351639 TTCCCAGGAGGTCTCACAGTTGG - Intronic
1132490394 16:226006-226028 GTCAAAGGAAGTTTCACTGTAGG - Intronic
1143405874 17:6676963-6676985 GACCCACCACGTCACACTGTGGG + Intergenic
1144395711 17:14841083-14841105 GTCCCACCAAGTATCACTATAGG - Intergenic
1152769022 17:82156384-82156406 GCCCCAGGAGCTCTCACTGTTGG - Intronic
1160192154 18:76723273-76723295 GTCCCAGGAAGTTCCACTGCAGG + Intergenic
1161013530 19:1971350-1971372 GGGCCACGAAGCCTCACTGCCGG + Intronic
1164187780 19:22886439-22886461 TTCCCAAGCAGTCACACTGTTGG + Intergenic
1165497394 19:36161259-36161281 GTCCCATAAATTCTCACTATGGG + Intergenic
944108382 2:196104068-196104090 TTCCCAAGAAGTCTCCCGGTAGG + Intergenic
945503088 2:210602296-210602318 GTCCATCAAAGTCTCTCTGTTGG - Exonic
1170166574 20:13365812-13365834 GTCTTACGAAGTCTGGCTGTGGG + Intergenic
1175466042 20:59191840-59191862 GTCCCAAGGAGCCTCTCTGTCGG - Exonic
1175969167 20:62675261-62675283 GCACCACGAAGTCTCACTGCCGG - Intronic
1176878836 21:14167087-14167109 CGCCCACGGAGTCTCACTGATGG + Intronic
1177444460 21:21174474-21174496 GTCCCAAGCTGTCTCACTATAGG - Intronic
1180220519 21:46355430-46355452 GTCCCACGTGGTTTCTCTGTAGG + Exonic
953027796 3:39154616-39154638 CTCCCACGAAGGCTCCCTGGAGG - Intergenic
961527861 3:127518559-127518581 GTCCCAGGAATTATCACTGGGGG + Intergenic
964690482 3:159444190-159444212 GTCCCACACAGTCTCCCTGAGGG - Intronic
981212931 4:142130209-142130231 TTCCTACAAAGCCTCACTGTGGG - Intronic
988293565 5:29324179-29324201 GTCCCAGGAAATCCCACTTTGGG + Intergenic
994189668 5:96855772-96855794 GTCCCAAGACATCTCCCTGTTGG + Intronic
996749525 5:126874855-126874877 GTCCCAACAAGGCTCACTGTGGG - Intronic
997223175 5:132187346-132187368 GTCACATGAAGTCTCATTGCTGG - Intergenic
1013301412 6:108808443-108808465 GTCCCATGAAGGCTCCATGTGGG - Intergenic
1022256376 7:28662519-28662541 GGCCCCCGAAGACTTACTGTGGG - Intronic
1024360139 7:48459636-48459658 GCTCCAGGAAGTCTCCCTGTAGG - Intronic
1029451192 7:100642533-100642555 GTCCCACCAAGTTTCCCTTTCGG + Intronic
1031018549 7:116601639-116601661 GGCCCTGGAAGTGTCACTGTGGG - Intergenic
1035321963 7:158035798-158035820 GTCCCAAGAACTCTCATTGTTGG - Intronic
1035744419 8:1951399-1951421 GTCCCAGGAATTCTGAATGTTGG - Intronic
1036659797 8:10700551-10700573 ATCACAAGAAGTCTCTCTGTGGG - Exonic
1046127827 8:109932216-109932238 GTCCCATCCTGTCTCACTGTTGG - Intergenic
1049131695 8:140850406-140850428 TTGAGACGAAGTCTCACTGTTGG - Intronic
1049384889 8:142338222-142338244 GTCCCCCCACGTCTCACTGCAGG + Intronic
1057072646 9:92113495-92113517 GTTCTCCCAAGTCTCACTGTTGG + Intronic
1193132854 X:77935990-77936012 GACCCAAGAACTCTCACTCTGGG - Intronic
1197935256 X:131734181-131734203 TTCCCAGGAAGCCTCGCTGTGGG + Intergenic