ID: 1076685927

View in Genome Browser
Species Human (GRCh38)
Location 10:132198500-132198522
Sequence GAGTTGGCTCGGGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076685927_1076685933 0 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685933 10:132198523-132198545 CGCCCAGACCACTGCTGCCTGGG 0: 1
1: 0
2: 4
3: 20
4: 252
1076685927_1076685932 -1 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685932 10:132198522-132198544 CCGCCCAGACCACTGCTGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 239
1076685927_1076685934 1 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685934 10:132198524-132198546 GCCCAGACCACTGCTGCCTGGGG 0: 1
1: 0
2: 4
3: 48
4: 356
1076685927_1076685940 22 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685940 10:132198545-132198567 GGCTGTGCTGACCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 60
4: 445
1076685927_1076685942 30 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685942 10:132198553-132198575 TGACCCTGGCCCTGGGCTCCTGG 0: 1
1: 0
2: 4
3: 82
4: 583
1076685927_1076685941 23 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685941 10:132198546-132198568 GCTGTGCTGACCCTGGCCCTGGG 0: 1
1: 0
2: 2
3: 42
4: 376
1076685927_1076685938 16 Left 1076685927 10:132198500-132198522 CCACAGCACACCCGAGCCAACTC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1076685938 10:132198539-132198561 GCCTGGGGCTGTGCTGACCCTGG 0: 1
1: 1
2: 2
3: 70
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076685927 Original CRISPR GAGTTGGCTCGGGTGTGCTG TGG (reversed) Intronic
900859109 1:5212927-5212949 CAGTTGGCTTGTGTGTGTTGAGG - Intergenic
901104257 1:6743254-6743276 GTGGTGACTCGGGTGTGGTGAGG - Intergenic
901454074 1:9353295-9353317 GAGCTGGGTCTGGTGTGGTGCGG - Intronic
905775261 1:40664222-40664244 GGGTTGGCAGGGATGTGCTGGGG - Intronic
905940708 1:41861039-41861061 GCCCTGGCTCGAGTGTGCTGAGG - Intronic
911096939 1:94062503-94062525 GAGTGGGCTGGGGTGGGCTGGGG - Intronic
912319159 1:108693511-108693533 GTGCTGGCTTGGCTGTGCTGGGG + Intronic
912771127 1:112465087-112465109 GATTTGGGTTGGGTGGGCTGAGG - Intergenic
914764082 1:150622718-150622740 GAGGTGGCTCGGGTGTGGGCTGG - Exonic
917135016 1:171781393-171781415 GAGTGAGCGCGGCTGTGCTGTGG - Intergenic
920677477 1:208048287-208048309 GGGTAGGCCCAGGTGTGCTGAGG + Intronic
921922309 1:220683589-220683611 GAGTTAGCTCAGCTGTGGTGGGG - Intergenic
923629994 1:235643327-235643349 GAGCTGGCCCTGGTGAGCTGAGG - Intronic
1064849781 10:19697703-19697725 GAGGTGGCTCTGCTGGGCTGTGG - Intronic
1068957030 10:62827475-62827497 GAGGTGGCTCGAGTGTGGTTGGG + Intronic
1069781986 10:70962700-70962722 GAGTTGGGTTGGGTGGGCTTGGG - Intergenic
1070820505 10:79351391-79351413 GGGTGGGCTTGGGTGGGCTGAGG + Intronic
1073073199 10:100807679-100807701 GTGTGGGAGCGGGTGTGCTGGGG - Intronic
1073289899 10:102408427-102408449 GATTTGCCTTGGTTGTGCTGGGG - Intronic
1074358195 10:112804214-112804236 GAGAAGGCTCGGCTGTGCTCAGG + Intronic
1076685927 10:132198500-132198522 GAGTTGGCTCGGGTGTGCTGTGG - Intronic
1076909006 10:133378216-133378238 GGGTTGGCTAGGGAGTGATGGGG + Intergenic
1085339194 11:75720203-75720225 GAGTTGGCTGGGGTGTGGTCAGG + Intronic
1086146595 11:83559246-83559268 GGGTTTGCTTGGGTGTGCAGGGG + Intronic
1086966935 11:93038076-93038098 GAGTTTGCTGGAGGGTGCTGTGG + Intergenic
1089096760 11:115925985-115926007 GTGTTGGGTTGGGTGTGCAGGGG + Intergenic
1089138460 11:116267987-116268009 GAGTGGGCAGGGGTGTGGTGTGG - Intergenic
1089406591 11:118202754-118202776 GAGTTGGCTGTGGTTGGCTGGGG - Intronic
1090922397 11:131217849-131217871 CAGATGGATTGGGTGTGCTGAGG + Intergenic
1094362162 12:29641335-29641357 GAGGTGGCTGGGGTGTGCAATGG - Intronic
1094498744 12:31005496-31005518 GGGTGGGCTGGGGTGTGCTCTGG - Intergenic
1096421568 12:51462925-51462947 AAATTGGCTCAGGTGTGATGGGG + Intronic
1101672424 12:106888518-106888540 GTGTGGGCCCAGGTGTGCTGTGG - Intronic
1102801790 12:115741473-115741495 GAGGTGGCAGGGGTGAGCTGAGG + Intergenic
1103883764 12:124186072-124186094 CAGTGGGCTGGGGTGTGCAGGGG + Intronic
1104083694 12:125456213-125456235 AAATAGGCTCGGGGGTGCTGTGG - Intronic
1104752111 12:131246284-131246306 GAGGTGTCAGGGGTGTGCTGAGG + Intergenic
1107423224 13:40269060-40269082 GAGTGGGCTGGGGTATGATGGGG - Intergenic
1107439203 13:40409507-40409529 GAGCTGTCTGGGGTTTGCTGGGG + Intergenic
1107479433 13:40773063-40773085 TGGTTTGCTCTGGTGTGCTGGGG + Intergenic
1116018024 14:39430871-39430893 GAGTTGGCCAGGGTCTGCAGAGG - Intronic
1122843118 14:104476338-104476360 GAGGTGGCTCCAGTGTGCAGTGG - Intronic
1122972705 14:105158861-105158883 TGGTTGGATGGGGTGTGCTGAGG - Intronic
1123035870 14:105471720-105471742 GAGTTGGCTGGTGGGGGCTGGGG - Intergenic
1124652674 15:31484907-31484929 GAGTGGGCTCTGATCTGCTGCGG + Intronic
1128109047 15:65065019-65065041 CAGTTGTCTGGGGTGGGCTGTGG + Intronic
1131259504 15:90881205-90881227 GACTTGGCTTGGGGCTGCTGTGG + Intronic
1132162437 15:99555767-99555789 GAGTTTGCTGGTGTGTGCAGTGG + Intergenic
1136012319 16:27371874-27371896 GAGTAGGGCCTGGTGTGCTGGGG - Intergenic
1137784671 16:51128404-51128426 GGGTTGGCTGGGGTTGGCTGGGG + Intergenic
1137875180 16:51989874-51989896 AGGGTGGCTGGGGTGTGCTGGGG + Intergenic
1138641662 16:58392621-58392643 GAGTGGAGTCGGGTGCGCTGGGG + Exonic
1139383166 16:66547436-66547458 GAGGTGGCTGGGGAGGGCTGGGG - Intronic
1139618146 16:68113617-68113639 GAGCAGGTTCGGCTGTGCTGGGG + Intronic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142978042 17:3656816-3656838 GTGTTGGCTGGGGTGGCCTGTGG - Intronic
1144237446 17:13275326-13275348 CAGTTGGCTGGGCTGGGCTGGGG + Intergenic
1144726554 17:17505293-17505315 GGGCTGTCTTGGGTGTGCTGGGG + Intergenic
1146487353 17:33254169-33254191 GAGGTGGCTCTGGGCTGCTGAGG + Intronic
1149855588 17:60079577-60079599 GAGTTGGAGAGGGTATGCTGTGG + Intergenic
1150467240 17:65403701-65403723 GGGTTGGGTCGCTTGTGCTGTGG - Intergenic
1151330603 17:73404773-73404795 GAGAAGGCTCGGGTGTGTTCTGG + Intronic
1159007331 18:63024540-63024562 GAGATGCTTGGGGTGTGCTGGGG - Intergenic
1159420065 18:68206303-68206325 GAGATGGCTGGGCTGTGCAGGGG + Intergenic
1160863162 19:1246048-1246070 CAGGTGTCTCGGGTGTCCTGAGG - Intergenic
1165151318 19:33762130-33762152 TGGGTGGCGCGGGTGTGCTGGGG + Intronic
1165695041 19:37894582-37894604 CAGTTGCGTCGGGTCTGCTGTGG - Exonic
1166640953 19:44495074-44495096 GAGTGGACTCTGGTGTGCAGTGG - Intronic
1167305811 19:48708685-48708707 GAGTGGGCTCTGTTGAGCTGAGG - Intergenic
927463992 2:23323579-23323601 GAGCTGGGTCGGGGCTGCTGGGG + Intergenic
928667073 2:33560231-33560253 TAGTTGGCTGGGGTGAGTTGGGG - Intronic
931797030 2:65721211-65721233 GAGTTGGCTTGGGGGTGGGGTGG + Intergenic
932614728 2:73224655-73224677 GAGTTGGAGTGGGAGTGCTGTGG + Intronic
934753323 2:96808567-96808589 GAGTGGGGTGGGGTGTGCTGGGG - Exonic
935162299 2:100539748-100539770 GAGTTGGGTTGGGTGGGATGTGG + Intergenic
935645174 2:105329066-105329088 GAGTAGGCAGGGGTGTGTTGGGG - Intronic
936493464 2:112996173-112996195 GAGGTGGCTCGGGTGGGAGGGGG + Intergenic
938682500 2:133705679-133705701 GTGTGGGCTCGTGAGTGCTGAGG + Intergenic
943718107 2:191174351-191174373 GAGTTGTCTCAGGAGTGCTCAGG + Intergenic
947668474 2:231922287-231922309 GAACTGGCTCCGTTGTGCTGAGG - Exonic
947740817 2:232484080-232484102 GAGCTGGCCCGGGTCTGCTTGGG - Exonic
947873831 2:233455267-233455289 GGGCAGGCTCGGGTGTGATGGGG - Intronic
947925537 2:233918929-233918951 GAGATGGCTGGGGTTTGGTGTGG + Intronic
948625242 2:239264541-239264563 GAGATGGCTTGGGTGAGCCGAGG + Intronic
949012589 2:241689702-241689724 GCGTTCGCTAGGTTGTGCTGTGG - Intergenic
1172120686 20:32597008-32597030 GAGTTTGCTGGGGTGGGGTGGGG - Intronic
1172800610 20:37573778-37573800 GAGAGGGCTGGGGTGAGCTGAGG + Intergenic
1173282755 20:41643965-41643987 GAGTTGGCTCAGGTGTGAATGGG - Intergenic
1173316500 20:41949575-41949597 GAGTTGGTTTTGCTGTGCTGTGG + Intergenic
1174190273 20:48735481-48735503 GAGTGAGCTGGGGTGGGCTGGGG - Intronic
1175492282 20:59387248-59387270 GAGGAGGCTCGGGGGGGCTGGGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1176142909 20:63553153-63553175 CAGCTAGCTGGGGTGTGCTGTGG + Intronic
1179627655 21:42657714-42657736 CTGTGGGCTCGGGTGTGGTGAGG + Intronic
1179771451 21:43621071-43621093 AAGTTGACTCTGGTGTTCTGTGG - Intronic
1181168290 22:20994753-20994775 GGGTTGGGTGGGGTGTGCTCAGG + Intronic
1183324834 22:37185546-37185568 GAGTTAGGTCAGGAGTGCTGTGG - Intronic
950011983 3:9730831-9730853 GGGTTGGCAGGGATGTGCTGCGG - Intergenic
950179781 3:10903143-10903165 GAATTGGCTTGTGTTTGCTGTGG - Intronic
951450055 3:22827183-22827205 GAGTTTGCTGGAGTTTGCTGTGG - Intergenic
953024380 3:39136510-39136532 GAGTTGGGTGTGGTGTGTTGAGG + Intronic
953061111 3:39429413-39429435 GAGTTGACTGGGGACTGCTGGGG - Intergenic
961414437 3:126746979-126747001 GAGGTGGCCCGGGAGTACTGGGG + Intronic
964473526 3:157078276-157078298 GAAGTCGCTAGGGTGTGCTGGGG - Intergenic
965865385 3:173199238-173199260 GAGTTGGTTGGGGGCTGCTGTGG - Intergenic
967319741 3:188183744-188183766 GAGTGGGAGGGGGTGTGCTGGGG + Intronic
968046632 3:195627699-195627721 GCGGTGGCTCTGGTGTCCTGCGG + Intergenic
968308024 3:197662341-197662363 GCGGTGGCTCTGGTGTCCTGTGG - Intergenic
968441152 4:625190-625212 ACCTGGGCTCGGGTGTGCTGGGG - Intergenic
968613870 4:1568742-1568764 GAGGTGGCGCGGGTGGGGTGGGG - Intergenic
968856244 4:3125927-3125949 GAGTTGGATGGGTTATGCTGGGG + Intronic
969666043 4:8558100-8558122 GAGCTGGTTCAGGTGTGCTTGGG + Intergenic
973839164 4:54843379-54843401 AAGTTGGCACGGGTGTGGTGGGG - Intergenic
975905694 4:79209490-79209512 GAGTTGGGTTGGGTGTTCAGTGG - Intergenic
983657765 4:170100124-170100146 GGGTGGGCTGGGGTGTGTTGGGG + Intergenic
984530418 4:180909401-180909423 GTGTTGGCTCTGGTGTGATGAGG - Intergenic
985933192 5:3075426-3075448 GAGTTGGGTGGGGTGGGGTGGGG - Intergenic
992982623 5:82192152-82192174 GAGTTGTAGCAGGTGTGCTGTGG + Intronic
993917095 5:93756468-93756490 GAGGTGGCTGTGGTGTGCAGGGG - Intronic
995835288 5:116394695-116394717 GAACTAGCTGGGGTGTGCTGGGG + Intronic
999258168 5:150221433-150221455 GAGGTGGGTGGGGGGTGCTGGGG + Intronic
999380346 5:151117097-151117119 GAGGTGACTGGGGTGGGCTGGGG + Intronic
1002698943 5:181109118-181109140 GAGGCTCCTCGGGTGTGCTGGGG + Intergenic
1002899934 6:1402072-1402094 GAGTCTGCTCGAGTGTACTGGGG - Intergenic
1004441636 6:15660716-15660738 GAGTGGGCTCTGGACTGCTGGGG - Intronic
1008011070 6:46468477-46468499 GCGTTGGCGCGGCTGTGGTGGGG - Intronic
1013005874 6:106072900-106072922 GATTTGACTCTGGTGGGCTGAGG + Intergenic
1013311476 6:108898521-108898543 GAGGTGGCTTTGCTGTGCTGAGG - Intronic
1014041046 6:116825754-116825776 CAGTTTGCTCAGGAGTGCTGTGG - Intronic
1014253639 6:119140207-119140229 GAGTTGCCTTGGGTGTGGTAGGG + Intronic
1015156537 6:130102621-130102643 GGGTTGGCTAGAGTGTGATGGGG - Intronic
1020133738 7:5574537-5574559 GAGAGGGCTCGGGGGTGGTGGGG - Intergenic
1020458477 7:8401444-8401466 GAGTTGACTCTGCTGTGCTATGG - Intergenic
1023858813 7:44204066-44204088 GTGCTGGCTCAGGTCTGCTGGGG - Intronic
1028268575 7:88759277-88759299 CAGGAGGCTCAGGTGTGCTGTGG - Intergenic
1031965164 7:128022690-128022712 GAGGGGGGTGGGGTGTGCTGGGG - Intronic
1035043519 7:155948516-155948538 GAGCAGCCTGGGGTGTGCTGTGG + Intergenic
1044256555 8:90070118-90070140 GAAATGGCTCGGGGTTGCTGGGG - Intronic
1045431993 8:102123605-102123627 GACTTGGGAAGGGTGTGCTGGGG - Intronic
1049683219 8:143929049-143929071 GGGTCGGCTGGGGGGTGCTGGGG - Intronic
1049778337 8:144416366-144416388 GAGTTGGCCCTGGGGTCCTGGGG + Intronic
1054817858 9:69492800-69492822 AAGTTGGCTAGGGCTTGCTGGGG - Intronic
1055907251 9:81309014-81309036 GTGTTGGCTGGGGTGTGCCTGGG - Intergenic
1057253586 9:93524636-93524658 GCGTCGGCTCGGCTCTGCTGTGG + Intronic
1061484085 9:130911661-130911683 GAGCTGGCTCAGGTGTGCCGAGG + Intronic
1062088448 9:134661144-134661166 GAGTTGCCTAGGGTGGCCTGGGG + Intronic
1062707568 9:137953856-137953878 GAGGTGCCTGGGCTGTGCTGAGG + Intronic
1203692353 Un_GL000214v1:56171-56193 GAGTGGGTTCTGGTGTTCTGTGG + Intergenic
1203556537 Un_KI270744v1:3063-3085 GAGTGGGTTCTGGTGTTCTGTGG + Intergenic
1203643942 Un_KI270751v1:48020-48042 GAGTGGGTTCTGGTGTTCTGTGG - Intergenic
1186378573 X:9033686-9033708 GGGTGGGCTAGGGTGGGCTGGGG - Intronic
1186506884 X:10100708-10100730 GAGTTGGCTCGGTGGGACTGAGG - Intronic
1186714281 X:12233729-12233751 GAGTTGGGTGGAGTGAGCTGGGG + Intronic
1190638405 X:52458998-52459020 GAGTTGGCCCTGGTGTCCAGGGG + Intergenic
1190678252 X:52801446-52801468 GAGTTGGCCCTGGTGTCCAGGGG - Intergenic
1195124062 X:101787489-101787511 GAGTATCCTAGGGTGTGCTGAGG - Intergenic
1195129192 X:101837896-101837918 GAGTTGGCCTGTGTCTGCTGGGG + Intronic
1195177042 X:102321934-102321956 GAGTTGGCCTGTGTCTGCTGGGG - Intronic
1195181822 X:102365159-102365181 GAGTTGGCCTGTGTCTGCTGGGG + Intronic
1197622411 X:128765274-128765296 TATTTGGTTCGGGTGTTCTGTGG + Intergenic
1200059909 X:153479581-153479603 GAGCGGGCTGGGGTGTGCTGGGG + Intronic