ID: 1076686418

View in Genome Browser
Species Human (GRCh38)
Location 10:132200287-132200309
Sequence CAGCAGTTCTCGGGGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076686410_1076686418 18 Left 1076686410 10:132200246-132200268 CCCAGGCAAGGAAAGTGAGGGGC 0: 1
1: 1
2: 2
3: 21
4: 277
Right 1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1076686411_1076686418 17 Left 1076686411 10:132200247-132200269 CCAGGCAAGGAAAGTGAGGGGCA 0: 1
1: 0
2: 4
3: 37
4: 329
Right 1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076686418 Original CRISPR CAGCAGTTCTCGGGGCCCCA GGG Intronic
900184161 1:1325160-1325182 CAGCAGGAGACGGGGCCCCACGG - Intronic
902752397 1:18526162-18526184 CAGCAGGTCTGGGTGTCCCAAGG + Intergenic
902863650 1:19263094-19263116 CAGCAGGTCTCGATGCTCCAGGG + Intergenic
902985013 1:20149761-20149783 CAACAGTGCTGGGGGCCGCAGGG - Exonic
903009630 1:20320507-20320529 CAGCAGTTCTCAGAGCTCAATGG - Intronic
903663654 1:24994072-24994094 CAGCAGGTCCCAGAGCCCCAGGG - Intergenic
904575081 1:31500231-31500253 CTGGAGATCTCTGGGCCCCACGG + Intergenic
906038463 1:42767436-42767458 CAGCCGGTCTCGGGGCTCCGCGG + Intronic
906329691 1:44874954-44874976 CAGTATTTCTCAGGGCCACAAGG + Intronic
913632647 1:120724419-120724441 CAGCGGTTGGCGGGGCACCACGG - Intergenic
917199192 1:172497524-172497546 CCACAGTTCTAAGGGCCCCAGGG - Intergenic
918474698 1:184911439-184911461 CAGCAGAGCTCTGGGCACCAGGG + Intronic
919690789 1:200526913-200526935 CACCAGTTCTCAGCTCCCCATGG - Intergenic
920684794 1:208101300-208101322 CTGCAGCTCCCGGGTCCCCACGG - Intronic
922326136 1:224530142-224530164 CTGCAGTTCCCTGGGTCCCAAGG + Intronic
922881000 1:228980505-228980527 CAGTGCTTCTCGGGTCCCCAAGG + Intergenic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
924707741 1:246512598-246512620 CAGAAGTGCTCAGGGCCCCCTGG + Intergenic
1065082052 10:22138810-22138832 CAGCACTTCGGGGGGGCCCAAGG - Intergenic
1067772015 10:49133382-49133404 CACCAGCTCTGGGGGCCCAATGG - Intronic
1067985654 10:51140879-51140901 CAGCAGTTCTCAGGACTTCAGGG - Intronic
1068635615 10:59344871-59344893 CAGCAGGTCTCGGAACCCAATGG + Intronic
1073447760 10:103591461-103591483 CAGCATTTCTAGGGGCCCAGAGG - Exonic
1076594819 10:131618987-131619009 CCTCGGGTCTCGGGGCCCCACGG - Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1077252276 11:1565956-1565978 CAGCAGTGCTGCGGGCCCCTGGG + Intronic
1077313264 11:1902797-1902819 CAGCAGCTCTCGGGGCTGCTCGG - Intergenic
1080640231 11:34154393-34154415 GAGCAGGTCTTGGGGACCCATGG + Intronic
1082026894 11:47579033-47579055 CAGCAGGACACGGAGCCCCAAGG - Exonic
1084235958 11:67788194-67788216 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1084289357 11:68151906-68151928 CAGCAGGGCTGGGGGCCCTAGGG - Intergenic
1089785395 11:120903677-120903699 CAGCAGGGCTGGGGGTCCCAGGG - Intronic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1091343601 11:134838260-134838282 CTGCAGCTCTCGGGCCTCCAGGG + Intergenic
1091713528 12:2760071-2760093 CAGCACTTCTGGGGGCCACAGGG - Intergenic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1091996386 12:4997418-4997440 CAGCTCTTCACTGGGCCCCAGGG - Intergenic
1092406865 12:8227557-8227579 CTGCAGGTCTCGGGGCTCCTGGG + Exonic
1094512774 12:31106146-31106168 AAGTAGTTCTCTGGGACCCATGG + Intergenic
1097682524 12:62662070-62662092 CAGCAGTTCTCGTGGACCCCAGG + Intronic
1100814098 12:98368864-98368886 GAGCAGTCATCTGGGCCCCAAGG - Intergenic
1103011628 12:117462655-117462677 CAGCAGTCCTAGGAGCCTCACGG + Exonic
1103392520 12:120584766-120584788 CAGCGGATCTCCGGGCCCCGGGG - Intergenic
1103941055 12:124501459-124501481 CAGCTGTCATCAGGGCCCCACGG + Intronic
1106224264 13:27773344-27773366 CCTCAGGTCTCGGTGCCCCACGG - Intergenic
1109486531 13:63029121-63029143 CAGCAGATTTCAGGGTCCCAGGG + Intergenic
1113251026 13:108452754-108452776 TAGGAGCTCTCGGGGCTCCAGGG - Intergenic
1117462129 14:55955687-55955709 CAGCACTTCTCGGAGTCCCAGGG - Intergenic
1122099675 14:99397584-99397606 CTACAGTCCTCTGGGCCCCACGG + Intergenic
1122500294 14:102193561-102193583 AAGTAGTTCTGGGAGCCCCAGGG - Intronic
1122821767 14:104350247-104350269 CAACTGTTCTGGGGGCCCCTGGG + Intergenic
1122848671 14:104514703-104514725 GAGGAGTCCCCGGGGCCCCAGGG + Intronic
1123219768 14:106844643-106844665 CAGGAGTTTTCGGGGCCGCCTGG + Intergenic
1128812958 15:70585498-70585520 CAGCAGTTCTCAGGAGCGCAGGG + Intergenic
1130032286 15:80326963-80326985 CAGCCCTTCTGGAGGCCCCACGG + Intergenic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1131206079 15:90448654-90448676 CTGCAGTCCTCGAAGCCCCAGGG - Exonic
1132864554 16:2086986-2087008 CCGCAGTGCTCAGGGCCCCGTGG + Intronic
1133100798 16:3478416-3478438 CTGCAGTTCTCGTGGGCCTAAGG + Intronic
1135625966 16:23995248-23995270 CAGAAGCTCTTGGGGCCCCTTGG - Intronic
1136547124 16:30961446-30961468 CACCAGCACTCGGGGCGCCAAGG + Exonic
1137735755 16:50721901-50721923 CAGCACTGCTCTGTGCCCCAGGG - Intronic
1138973196 16:62170971-62170993 CAGCATTTCTTGGGGTCACAAGG + Intergenic
1145356367 17:22158345-22158367 CAGCAGATTTCAGGGTCCCAGGG - Intergenic
1145761121 17:27425923-27425945 CAGAGGTACTCAGGGCCCCATGG - Intergenic
1145971609 17:28959614-28959636 CAGCAGAGCCCGGGGCCACAGGG - Intronic
1146161169 17:30560081-30560103 CAGAGGTGCTCAGGGCCCCATGG - Intronic
1147894185 17:43739907-43739929 CAGCAGCCCCCGGGGCCCCTGGG + Intergenic
1149995846 17:61405579-61405601 CAGCAGTTCTTTGGGCCGCTGGG + Exonic
1151323225 17:73363982-73364004 CAGCAGTTCTCGGTGAGCCTAGG - Intronic
1151349015 17:73520550-73520572 CTGCACCTCTCTGGGCCCCAGGG - Intronic
1151457242 17:74233292-74233314 CACCAGTCCTCAGGGCTCCAGGG + Intronic
1151728468 17:75897464-75897486 CAGCAGTGCTCGGGTCTGCAGGG - Intergenic
1151967550 17:77439358-77439380 CTGCAGCCCTGGGGGCCCCAGGG + Intronic
1152124350 17:78437560-78437582 CAGTGGTCCTCGGGGCCCCAAGG + Intronic
1152211995 17:79007636-79007658 CAGCAGTTCTCCTGGCCCTGTGG - Intronic
1152644599 17:81463002-81463024 CAGCCCCCCTCGGGGCCCCAGGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1160970379 19:1765277-1765299 CAGCAGTGCTGGGGGCGGCACGG - Intronic
1160981454 19:1818400-1818422 CCCCAGTTCTGGGGGCCTCAAGG + Intronic
1161400314 19:4064397-4064419 TAGGTGCTCTCGGGGCCCCATGG + Intronic
1164627141 19:29737294-29737316 CAGCAGCTCTCGAGGCCCCGGGG - Intergenic
1165902465 19:39175146-39175168 CAGCTGTGCTCCGGGCCCCTGGG + Intronic
1166808334 19:45499987-45500009 CAGAAGGCCTAGGGGCCCCAGGG - Exonic
1168151154 19:54449541-54449563 TTGGAGTTCTCGGGGCCCCGGGG + Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
927671565 2:25072792-25072814 CAGCAGTCCTGTGGGCCCCAAGG - Intronic
929138014 2:38643257-38643279 CAGCACTGCTGGGGGACCCAGGG + Intergenic
932423410 2:71614279-71614301 CAGAAGTTCTGGGAGCCCCAGGG - Intronic
935144812 2:100388468-100388490 CAAAAGTTCTTGGGTCCCCATGG + Intergenic
941142556 2:161803533-161803555 CAGCAGTTGTCAGGGCTTCAGGG - Intronic
948807605 2:240459729-240459751 CAGCAGCTGGCGGGGCCTCAAGG - Intronic
948992673 2:241562749-241562771 CTGCAGGTCACGCGGCCCCACGG - Intronic
1169076537 20:2763303-2763325 CAGAAGCTCTCTGGTCCCCAGGG - Intergenic
1169200492 20:3706847-3706869 CAGCCCTTCTCAGTGCCCCAGGG + Intronic
1171455693 20:25270890-25270912 CCGCAGTACCAGGGGCCCCAAGG - Intronic
1172795155 20:37531962-37531984 CCCCAGTTTTCTGGGCCCCAGGG - Intergenic
1172846431 20:37932161-37932183 CACCACTTCTCCGGGCCACACGG + Intronic
1174135310 20:48375039-48375061 CAGCCGTCCTGGGAGCCCCACGG + Intergenic
1175785400 20:61708668-61708690 CAGCATTTCTCTGAGCCCCAAGG - Intronic
1175839232 20:62016134-62016156 CAGCAGCTCTGGCGGCCACATGG - Intronic
1176062302 20:63177781-63177803 CAGCAGCGCGCGGGGCCCCCGGG + Intergenic
1177802001 21:25836987-25837009 CAGCAGTTCTTGGTGCTCCTTGG + Intergenic
1178773663 21:35528733-35528755 CAGCAGTGCTGGAGGCCCCCGGG - Intronic
1180700268 22:17777746-17777768 ATGCAGTTCTGGGGGCGCCATGG - Intergenic
1183713083 22:39518018-39518040 CAGCAGGTCTCTGGGCCTCAGGG - Exonic
1184039444 22:41934299-41934321 GAGCAGTCCTTGGGACCCCAGGG - Intergenic
1184681740 22:46075927-46075949 CAGCACTTCCCGGGTCCCCAAGG - Intronic
1184685554 22:46095201-46095223 CAGGAGTTCTGGGGCCCCCCAGG - Intronic
950232390 3:11287431-11287453 CAGCCGCTCTCAGGCCCCCATGG - Intronic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
950667008 3:14503732-14503754 GAGGAGTCTTCGGGGCCCCAGGG + Intronic
951492726 3:23290802-23290824 CAGCAGTTCTGGGGAGGCCAAGG + Intronic
953188318 3:40659246-40659268 TAGCAGCTCTCTGGCCCCCACGG + Intergenic
953679504 3:45028927-45028949 CATCTGTTCTTGGGGCCACATGG + Intronic
954148482 3:48645996-48646018 CAGCACTAGTGGGGGCCCCAGGG + Intronic
954415786 3:50392607-50392629 CAGAAGTACTCAGGGCCCAAGGG + Intronic
954744151 3:52777626-52777648 CAGCAGCCCCCGAGGCCCCATGG - Exonic
955751019 3:62185519-62185541 CGGCAGCTCTCTGGCCCCCAAGG - Intronic
957051924 3:75417992-75418014 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
961244561 3:125440350-125440372 CAGCAGGTCTGAGGGCCCCTAGG + Intergenic
966821865 3:183931221-183931243 CAGCAGTTCTCGCTTCTCCATGG - Intronic
968615839 4:1577401-1577423 CAGCAGCTCCCGTGGCCACAGGG + Intergenic
969370869 4:6730961-6730983 CTCCAGTTCTTGGGGCCCAAAGG + Intergenic
976492986 4:85693519-85693541 CAGCAGGTCCCTGTGCCCCAGGG - Intronic
978033732 4:103969672-103969694 CAGCAGTTCTATGGGCACCCTGG - Intergenic
978809093 4:112830971-112830993 CAGCAGTGCTGGGGGACCCGGGG - Intronic
982087741 4:151853563-151853585 CATGAGTTCTCTGGGCCACATGG - Intergenic
985747867 5:1657338-1657360 CAGCAGTTCGTGGCGCCCCGTGG + Intergenic
985888444 5:2697956-2697978 CAGCAGCTCGAGGGGCCACAGGG + Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
986667556 5:10116678-10116700 CAGCAGTGCTGGGGGCTCCTTGG - Intergenic
987335973 5:16898129-16898151 AAGCAGCTCACAGGGCCCCAGGG + Intronic
992003589 5:72457636-72457658 CTGCAGTTCTGGTGGGCCCATGG + Intronic
992200641 5:74380554-74380576 CAGCAGTACTCAGGTCCCCAGGG - Intergenic
992758629 5:79932393-79932415 CTGAAGTTCTTGGGGCCCCAAGG + Intergenic
995979021 5:118078853-118078875 CAGCAGATCTCGGAGCCAGAGGG - Intergenic
997068405 5:130590228-130590250 GGCCAGTTCTCGGGCCCCCAGGG - Intergenic
1001100185 5:168807902-168807924 CAATAGTCCTCGTGGCCCCAAGG + Intronic
1001710086 5:173771579-173771601 CAGCATTTCCCGGTGCTCCACGG + Intergenic
1002599309 5:180345300-180345322 AAGCAGTTCTCAGGCCCACAAGG + Intronic
1003560029 6:7172605-7172627 AAGCAGCTCACGGTGCCCCATGG + Intronic
1003884236 6:10506523-10506545 TAGCAGCTCTCAGGGACCCAGGG + Intronic
1006119344 6:31794954-31794976 CAGCAGGCCTGGGGGGCCCAGGG - Exonic
1011021695 6:82820549-82820571 CAGCAATTTTCTGGGCTCCATGG + Intergenic
1023095231 7:36653655-36653677 CAGCAGTTCAGGAGGCCCCAGGG + Intronic
1026010148 7:66629532-66629554 CATCAGCTCTCGGGGCTCCAGGG - Intronic
1027264348 7:76485883-76485905 CAGCACTTCTGGGGGCCCTCAGG - Intronic
1027315718 7:76983997-76984019 CAGCACTTCTGGGGGCCCTCAGG - Intergenic
1028327921 7:89549761-89549783 GAGCAGTTCTCTGGGCACTAGGG + Intergenic
1029114900 7:98231856-98231878 GAGCAGTTCACGGGGCACGACGG - Exonic
1031363413 7:120874616-120874638 CAGAAGTTCTTGCTGCCCCATGG + Intergenic
1033280627 7:140003942-140003964 GACCATTTCTCGGTGCCCCATGG - Intronic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1034893835 7:154862612-154862634 CAGCAGCTCTCGGTGCCTCGAGG + Intronic
1035716384 8:1758404-1758426 CAGCAGTTCTTAGGACCTCATGG - Intronic
1036381418 8:8238457-8238479 CTGCAGGTCTCGGGGCTCCTGGG - Intergenic
1036528411 8:9556469-9556491 CAGCAGTGAGCGGGGCCCTACGG + Exonic
1036752957 8:11454874-11454896 CAGCAGCTCTGTGGGGCCCAGGG - Intronic
1036824324 8:11964329-11964351 CAGCACTTGTCAGGGTCCCAGGG + Intergenic
1036847242 8:12178535-12178557 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1036868609 8:12420856-12420878 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1036947876 8:13111893-13111915 CAGCAGTTTGGGAGGCCCCAAGG + Intronic
1037149131 8:15614459-15614481 AAGCAGTTGTCTGGGCCTCAAGG - Intronic
1040325038 8:46337384-46337406 GAGCAGTTCTGGGGGCTCCTGGG - Intergenic
1040440661 8:47438220-47438242 CAGCAGCTGTCAGGGCTCCATGG - Intronic
1040543578 8:48380362-48380384 GAGGAGTTCTCGGGACCCCCCGG + Intergenic
1044440846 8:92221823-92221845 TAGCAGTGATCGGGGCTCCATGG + Intergenic
1049431101 8:142565431-142565453 CAGCAGCTCTTGGGCTCCCAAGG + Intergenic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1057606024 9:96498331-96498353 CAGCAGATCAAGGGTCCCCAAGG + Intronic
1059324512 9:113496137-113496159 CAGGAGTGCTCTGGGCCCCAAGG - Intronic
1060600899 9:124876688-124876710 CAACAGCTCTCGGGACCCCACGG + Intronic
1060921679 9:127424737-127424759 CAGCAGTTCTCTGGGCGTAAGGG - Exonic
1062060393 9:134492384-134492406 CAGCAGTGCTCAGGGCCCCCGGG - Intergenic
1062127217 9:134870252-134870274 CAGCAGGTCTCGCAGCCCCACGG + Intergenic
1191184308 X:57592812-57592834 CAGCGGTCCGCGGGGGCCCAGGG - Exonic
1191213083 X:57909647-57909669 CAGCAGTCCGCGGGGGCCCAGGG + Exonic
1193252164 X:79304019-79304041 GATCAGTTCTAGGGGCCCCCTGG - Intergenic
1199965271 X:152814760-152814782 CAGTAGTTCCAGGGGCCCCTAGG - Intergenic
1200231280 X:154444981-154445003 CATCAGGACTCGGGGCTCCAGGG + Intronic