ID: 1076686938

View in Genome Browser
Species Human (GRCh38)
Location 10:132202421-132202443
Sequence CCTTTGTCCTCGAGAGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076686931_1076686938 -10 Left 1076686931 10:132202408-132202430 CCCACGCCTGTCCCCTTTGTCCT 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686924_1076686938 23 Left 1076686924 10:132202375-132202397 CCTAGCCAAGGGAGAAGTGACCC 0: 1
1: 0
2: 0
3: 25
4: 239
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686923_1076686938 27 Left 1076686923 10:132202371-132202393 CCTGCCTAGCCAAGGGAGAAGTG 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686925_1076686938 18 Left 1076686925 10:132202380-132202402 CCAAGGGAGAAGTGACCCTCCCT 0: 1
1: 0
2: 5
3: 37
4: 799
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686927_1076686938 2 Left 1076686927 10:132202396-132202418 CCTCCCTGCCTGCCCACGCCTGT 0: 1
1: 0
2: 6
3: 95
4: 731
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686929_1076686938 -2 Left 1076686929 10:132202400-132202422 CCTGCCTGCCCACGCCTGTCCCC 0: 1
1: 0
2: 8
3: 77
4: 676
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686930_1076686938 -6 Left 1076686930 10:132202404-132202426 CCTGCCCACGCCTGTCCCCTTTG 0: 1
1: 0
2: 3
3: 20
4: 324
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686926_1076686938 3 Left 1076686926 10:132202395-132202417 CCCTCCCTGCCTGCCCACGCCTG 0: 1
1: 1
2: 11
3: 100
4: 798
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data
1076686928_1076686938 -1 Left 1076686928 10:132202399-132202421 CCCTGCCTGCCCACGCCTGTCCC 0: 1
1: 0
2: 9
3: 72
4: 571
Right 1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076686938 Original CRISPR CCTTTGTCCTCGAGAGAAAC GGG Intronic
No off target data available for this crispr