ID: 1076687110

View in Genome Browser
Species Human (GRCh38)
Location 10:132203147-132203169
Sequence CCAACTGGGCAGCTCCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076687110_1076687118 -1 Left 1076687110 10:132203147-132203169 CCCCACGGGAGCTGCCCAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1076687118 10:132203169-132203191 GACCTCAGTGTGGGTCCTTCTGG No data
1076687110_1076687119 0 Left 1076687110 10:132203147-132203169 CCCCACGGGAGCTGCCCAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1076687119 10:132203170-132203192 ACCTCAGTGTGGGTCCTTCTGGG No data
1076687110_1076687121 11 Left 1076687110 10:132203147-132203169 CCCCACGGGAGCTGCCCAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1076687121 10:132203181-132203203 GGTCCTTCTGGGATTCCCCATGG No data
1076687110_1076687115 -10 Left 1076687110 10:132203147-132203169 CCCCACGGGAGCTGCCCAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1076687115 10:132203160-132203182 GCCCAGTTGGACCTCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076687110 Original CRISPR CCAACTGGGCAGCTCCCGTG GGG (reversed) Intronic
901891689 1:12271838-12271860 CCAAATGGCCAGCTGCCATGAGG + Intronic
902409227 1:16203030-16203052 CCAACTGGACAGCTCCCCTGAGG + Intronic
902737766 1:18412614-18412636 GCAACTGGGCAGGTCCCAGGGGG - Intergenic
906992299 1:50752201-50752223 CAAGGTGGGCAGCTCCCCTGAGG - Intronic
913451384 1:118994947-118994969 ACAACTGGGCAGCTCCCTGGTGG + Intergenic
914869957 1:151464804-151464826 CCATCTGAGCAGCTCCCAGGTGG + Intergenic
919631762 1:199966396-199966418 CAAACTGGGCAGATCACCTGAGG + Intergenic
920249597 1:204614728-204614750 CCAACTGGGGAGTGCCCCTGCGG + Intergenic
920854174 1:209650074-209650096 CCAACAAGCCTGCTCCCGTGGGG - Exonic
923305091 1:232681481-232681503 CTGGCTGGGCAGCTCCCTTGGGG - Intergenic
923617794 1:235552187-235552209 CCTACTGTGAAGCTCACGTGCGG - Exonic
1062808209 10:440970-440992 CCGCCTGGACAGCTTCCGTGTGG + Exonic
1065495528 10:26323618-26323640 CCAGCTGGGCAGATCACTTGAGG + Intergenic
1065510668 10:26475353-26475375 CCAGGTGGGCAGATCACGTGAGG - Intronic
1065762036 10:28991427-28991449 CAAACTGGGCTGCTCGCCTGTGG + Intergenic
1066438003 10:35412020-35412042 CCAAAGGAGCAGCTCCTGTGTGG + Intronic
1071582463 10:86785535-86785557 CCAAGTGGGCAGATCACCTGAGG - Intronic
1072680059 10:97499495-97499517 CCAACTGGGTAGCTCCTGGTGGG + Intronic
1073038400 10:100580528-100580550 CCAACTGGGCAGGTCCATGGTGG - Intergenic
1073274861 10:102301544-102301566 CAGACTGGGCAGCTGCCGGGCGG + Intronic
1073479465 10:103777408-103777430 CCAGCTGGGCAGCTCCCCTGGGG - Intronic
1076687110 10:132203147-132203169 CCAACTGGGCAGCTCCCGTGGGG - Intronic
1077094035 11:791869-791891 CCAGCTGGGCAGGGCCGGTGTGG - Exonic
1078122440 11:8523631-8523653 CGGACTGGGCAGCTGCCGGGCGG - Intronic
1078142081 11:8700047-8700069 CCCCCAGGCCAGCTCCCGTGGGG - Intronic
1081727098 11:45338039-45338061 CCATCTGGGCAGCTTTCCTGAGG - Intergenic
1082822860 11:57556350-57556372 CAAAGTGGGCAGATCCCCTGAGG + Intronic
1083130707 11:60622171-60622193 CAAACGGGGCAGCTTCCGGGCGG - Intergenic
1083267414 11:61553216-61553238 CCAACTGGGAAGATCCTATGCGG + Intronic
1083603964 11:63966069-63966091 CAAGCTGGGCAGCTCACCTGAGG - Intergenic
1083734257 11:64670607-64670629 CCAACTGGTCAGCTCCTGAGGGG + Intronic
1083759541 11:64808073-64808095 CAAATTGGACAGCTCCGGTGTGG - Exonic
1084650782 11:70488049-70488071 CCAAGTGGGCAGCTCGCCTTGGG + Intronic
1084864667 11:72045989-72046011 CCAGCTGTGCAGCTTCCGAGAGG + Intronic
1084962185 11:72722680-72722702 CCAGCTGGGCAGCTGCCTTCTGG + Intronic
1085727098 11:78963666-78963688 CCAAGTGGGCTGCTCTTGTGTGG - Intronic
1088282540 11:108150274-108150296 CCAGATGGGCAGCTCACCTGAGG + Intergenic
1089257239 11:117200402-117200424 CCCACTGGGCAGCTCAGGGGAGG + Intronic
1089345751 11:117790364-117790386 CAAACTTGGCAGATCCCTTGAGG - Intronic
1090086291 11:123654005-123654027 CGAACTGGGGAGGTCCAGTGGGG - Exonic
1091526974 12:1312589-1312611 CAAACTGGGCAGATCACTTGAGG - Intronic
1092261504 12:6955591-6955613 CCATCGGGGGAGCTCACGTGGGG - Intronic
1094702565 12:32884219-32884241 CCAAGTGGGCAGATCGCCTGAGG + Intronic
1095198811 12:39357675-39357697 CAAAGTGGGCAGATCACGTGAGG + Intronic
1097019312 12:56008370-56008392 CCAAGTTTGCAGCTCCCGTCTGG - Intronic
1097785704 12:63756588-63756610 CCTACAGGGGAGCTTCCGTGAGG - Intergenic
1100450370 12:94700047-94700069 CCAACTTGGCTGGTCCGGTGTGG + Intergenic
1100556646 12:95701044-95701066 CCAAGTGGGCAGATCACCTGAGG - Intronic
1101002984 12:100374882-100374904 CCAACTGGAGAGCTGCTGTGAGG + Intronic
1102344370 12:112149833-112149855 CCTCCTGGGCAGCTCTGGTGAGG - Exonic
1102627484 12:114247018-114247040 CCAACTGGGTAGCTTCCCTTGGG + Intergenic
1102986845 12:117285224-117285246 CCAGCTGGTCAGCTCACCTGAGG + Exonic
1103410527 12:120708680-120708702 CCAATTGGGCAGCTGGGGTGGGG + Intergenic
1105744433 13:23363457-23363479 CCAAGTGGGCAGATCACCTGAGG - Intronic
1110237257 13:73229830-73229852 CCAAGTGGGCAGATCACTTGAGG + Intergenic
1113765766 13:112880339-112880361 CCAGCAGGGCCGCTCCCATGAGG - Intronic
1116837128 14:49780217-49780239 CCAACTGGGCATATGCCTTGTGG - Exonic
1119265039 14:73259460-73259482 CCATCGGGGCAGCACCCGTGAGG - Exonic
1123475774 15:20591992-20592014 TGACCTGGGCAGCTCCAGTGTGG - Intergenic
1123642236 15:22408371-22408393 TGACCTGGGCAGCTCCAGTGTGG + Intergenic
1124980693 15:34566639-34566661 TCAACAGGGCAGCCCCCGTCTGG - Intronic
1129603051 15:77011408-77011430 CCAGCTGGGCTGCTCAGGTGAGG + Intronic
1131544256 15:93302582-93302604 CCAACTGGGCGGCTCCAGAAGGG + Intergenic
1132698757 16:1213368-1213390 CCAACTTGGGAGCTCCAGGGGGG + Intronic
1134417639 16:14058139-14058161 CCAACTGGGCAGCTTCCCGGGGG + Intergenic
1134584511 16:15398274-15398296 CCAAATGGGCAGATCACTTGAGG - Intronic
1135270463 16:21065391-21065413 CGAAGTGGGCAGATCACGTGAGG - Intronic
1135822602 16:25697575-25697597 TCTACTGGGCAGCACCTGTGTGG + Intronic
1137440708 16:48496783-48496805 CCACCTGGACAGCTCCTGTGAGG - Intergenic
1137739945 16:50759004-50759026 CGAAGTGGGCAGATCACGTGAGG + Intronic
1138084934 16:54124844-54124866 CCAACCTGGCAGCTCCCTAGGGG + Intergenic
1139210940 16:65076107-65076129 CCAACAAGCCAGCTCCCTTGAGG + Intronic
1139525945 16:67516770-67516792 AAAACTGGGCAGCTCCAGAGAGG + Intergenic
1141136987 16:81472907-81472929 CTCACTGGGCAGCTGCGGTGTGG - Intronic
1141259029 16:82433553-82433575 CCAGCTGGGCAGATCACCTGAGG - Intergenic
1141722380 16:85763583-85763605 CCTCCTGGGCACCTCCTGTGGGG + Intergenic
1146821999 17:35990887-35990909 CAAAGTGGGCAGATCCCTTGAGG - Intronic
1148038940 17:44690668-44690690 CAAAGTGGGCAGCTCACCTGAGG + Intergenic
1150642781 17:66960862-66960884 CAAACTGCGGAGCTCCCGTTGGG + Intergenic
1151963283 17:77418745-77418767 CCAGCTGGGGAGCTCCCGAGGGG - Intronic
1151978339 17:77494887-77494909 CCAGCTGGGCAGCTCCCGCAGGG - Intronic
1152247987 17:79195819-79195841 CCTAGTGGCCAGCTCCCGTGCGG + Intronic
1152706242 17:81845072-81845094 CCAAGTGGGCATGTCCCGTGGGG + Intronic
1152916164 17:83037251-83037273 GGAACAGGGCAGCCCCCGTGGGG - Intronic
1153279250 18:3398745-3398767 CCAGTTGGGCAGGTCCCCTGAGG + Intergenic
1165315599 19:35053516-35053538 CCAAATGGGCAGATCACTTGAGG + Intronic
925263888 2:2551048-2551070 CCATGTGGGCAGCTGCCCTGGGG - Intergenic
925846817 2:8042481-8042503 CCACCTTGGCAGCTCCTGAGAGG + Intergenic
926158481 2:10471496-10471518 CCAGCAGGGCGGCCCCCGTGGGG + Intergenic
926809032 2:16740217-16740239 CCAGCTGGGCACCTCCAGCGTGG - Intergenic
929916958 2:46144144-46144166 CAAACAGTGCAGCTCCCTTGGGG - Intronic
932410261 2:71543061-71543083 CGGACTGGGCAGCTGCCGGGCGG + Intronic
937098045 2:119248412-119248434 CCAACTGGGCTGTACCCATGGGG - Intronic
938289720 2:130142803-130142825 CCATCTGGGCAGCAACCATGGGG - Intronic
938466806 2:131530135-131530157 CCATCTGGGCAGCAACCATGGGG + Intronic
939532588 2:143382726-143382748 GCAATTGGGAAGATCCCGTGAGG + Intronic
941508278 2:166375458-166375480 ATAGCTGGGCAGCTCCTGTGCGG - Intronic
941829993 2:169945469-169945491 CCATCTGGGCAGCTTCTGTGAGG + Intronic
945772531 2:214062185-214062207 CGAAGTGGGCAGATCCCTTGAGG + Intronic
947508219 2:230726402-230726424 CGAAGTGGGCAGCTCACTTGAGG - Intronic
947596261 2:231413594-231413616 CCAGCTAGGCAGCTCCAGTATGG - Intergenic
948595609 2:239077372-239077394 CCAAGTGGGCAGGTCCCCTGAGG + Intronic
1169343275 20:4811936-4811958 CCAACTGGCCAGGTCTCCTGAGG + Intronic
1171298761 20:24041337-24041359 CCAACTGGACAGATCCCCAGGGG - Intergenic
1171386713 20:24774474-24774496 CCAACTGTGCAGCTCCCTCTGGG - Intergenic
1171973114 20:31576979-31577001 CCAACTGGGCTGATCCCAGGGGG - Intronic
1172654209 20:36526940-36526962 CCAAGCGGGCAGCTTCTGTGCGG + Exonic
1175247607 20:57591207-57591229 CCAACTGAGCAGCTCTTCTGTGG + Intergenic
1176150557 20:63588776-63588798 CCAACAGGGCATGTCCCGGGAGG - Exonic
1178303425 21:31471177-31471199 CCACCTGGGCATTTCCTGTGTGG - Intronic
1178954803 21:37012471-37012493 CCAAGTGGGCAGATCACTTGAGG - Intronic
1179878971 21:44285678-44285700 CCACCAGGGCAGCTGCCTTGGGG - Intergenic
1180057126 21:45364798-45364820 CTCTCTGGGCAGCACCCGTGGGG - Intergenic
1180783584 22:18535011-18535033 CCACCTGGGCAGGGCTCGTGAGG - Intergenic
1181127151 22:20709062-20709084 CCACCTGGGCAGGGCTCGTGAGG - Intronic
1181240486 22:21474363-21474385 CCACCTGGGCAGGGCTCGTGAGG - Intergenic
1181283875 22:21738483-21738505 CCAAGTGGGCAGATCACCTGAGG + Intergenic
1181297016 22:21847835-21847857 CCGACGGGGCAGCTGCCGGGCGG - Intronic
1182269878 22:29146502-29146524 CCACGATGGCAGCTCCCGTGCGG - Intronic
1182882650 22:33746944-33746966 ACACCTGGGCACCTCCCCTGAGG + Intronic
1183492675 22:38124949-38124971 CCAAGTGGGGAGCTACCGAGGGG + Intronic
949522662 3:4870909-4870931 CCAAGTGGGCAGATCACTTGAGG - Intronic
954004915 3:47583086-47583108 CCAGCTGGGCAGATCACCTGAGG - Intergenic
955237931 3:57156329-57156351 CCAAGTGGGCAGATCGCTTGAGG + Intronic
958788219 3:98622275-98622297 CCAAATGGGCAGATCACTTGAGG - Intergenic
959057682 3:101584165-101584187 CCTACTGGGCAGCTCCACTTAGG - Intronic
962102776 3:132359854-132359876 TCACCTGGGCAGCTCCAATGTGG + Intronic
966381692 3:179351035-179351057 CGAAGTGGGCAGATCCCTTGAGG - Intronic
968237969 3:197048887-197048909 CCAGGTGGGCAGGTCCCCTGAGG - Intronic
968690130 4:1986053-1986075 CCAACTGGGCAGGGCCCGCAGGG + Intronic
969694422 4:8726521-8726543 TCTCCTGGGCAGCTGCCGTGAGG - Intergenic
972618769 4:40725579-40725601 CAAAGTGGGCAGATCCCTTGAGG + Intergenic
974293637 4:59966220-59966242 CCAAGTGGGCAGATCACTTGAGG - Intergenic
977159986 4:93621995-93622017 CCTACTGGGGAGGTCCCTTGAGG + Intronic
978788912 4:112640467-112640489 CCAAATGGGCAGATCACTTGAGG + Intronic
980532235 4:134070766-134070788 CCAACTGGGATGCTACCCTGGGG - Intergenic
982820930 4:159939854-159939876 CAAACGGGGCAGCTGCCGGGCGG + Intergenic
986168550 5:5296712-5296734 ACAAAGGGGCAGCTGCCGTGGGG - Intronic
992844437 5:80731134-80731156 CCAAGTGGGCAGATCACTTGAGG - Intronic
996386915 5:122918174-122918196 CCAAGTGGGCAGATCACCTGAGG + Intronic
997761970 5:136457929-136457951 CCCAATGGGCAGCTACAGTGAGG + Intergenic
1001376100 5:171260065-171260087 CCAAGTGGGCAGATCACTTGAGG + Intronic
1001800690 5:174541520-174541542 CCACCTGGGCCCCTCCAGTGTGG - Intergenic
1002301963 5:178262465-178262487 CCAACTGAGCAGCTGTCCTGGGG + Intronic
1010213679 6:73383068-73383090 CCAGGTGGGCAGATCCCTTGAGG - Intronic
1011629182 6:89308239-89308261 CCATCTGGGCAGAGCCGGTGAGG - Intronic
1016311118 6:142734566-142734588 CAAAGTGGGCAGATCCCCTGAGG + Intergenic
1018629312 6:165808458-165808480 CTAACTGGGCAGCTCTAGAGAGG + Intronic
1019531160 7:1504165-1504187 CCGACTGAGCCGCTCCCGGGCGG - Intronic
1019552688 7:1610997-1611019 CCAGCTCGGCAGCTCCAGTGTGG - Intergenic
1019697195 7:2452431-2452453 GAAACTGGGGAGCCCCCGTGAGG - Intergenic
1019697215 7:2452475-2452497 GAAACTGGGGAGCCCCCGTGAGG - Intergenic
1020069799 7:5219234-5219256 CCAACTGGGCAGCAACAGAGGGG + Intronic
1020156031 7:5725615-5725637 CCAAGTGGGCAGATCCCTTGAGG + Intronic
1020478682 7:8630408-8630430 GCAACTTGGGAGCTCCCATGAGG - Intronic
1023879009 7:44308102-44308124 CCTCCTGGGCACATCCCGTGTGG - Intronic
1024938006 7:54731784-54731806 GAAACTGGGCATCTCCCTTGCGG + Intergenic
1025634834 7:63313179-63313201 CCAGCTGGGCAGGTACCGGGAGG + Intergenic
1025647861 7:63434991-63435013 CCAGCTGGGCAGGTACCGGGAGG - Intergenic
1026150888 7:67787334-67787356 CCAGGTGGGCAGGTCCCCTGAGG - Intergenic
1026535863 7:71238105-71238127 AGAGCTGGGCAGCTCCCCTGTGG + Intronic
1028172852 7:87619304-87619326 CCAAGTGGGCAGATCACTTGAGG + Intronic
1029284318 7:99455576-99455598 CCAACTGGGCAGAGCCCCTCAGG + Intronic
1029746650 7:102519037-102519059 CGAAGTGGGCAGCTCACCTGAGG - Intergenic
1029764588 7:102618012-102618034 CGAAGTGGGCAGCTCACCTGAGG - Intronic
1033048661 7:137984495-137984517 CCAACGGGGCCCTTCCCGTGAGG - Intronic
1034785075 7:153918745-153918767 CCACCTGGGCAGATCACTTGAGG + Intronic
1035352527 7:158256588-158256610 GAACCTAGGCAGCTCCCGTGAGG + Intronic
1036760038 8:11502518-11502540 CGAACTGGGCAGATCACTTGAGG - Intronic
1038338158 8:26661943-26661965 CCAAGTGGGCCGCTTCCCTGGGG - Intergenic
1038957811 8:32486162-32486184 CGAAGTGGGCAGATCCCTTGAGG - Intronic
1043549746 8:81357054-81357076 CCAACTGGGCAGCTCAACTGAGG - Intergenic
1043692976 8:83180503-83180525 CCAAGTGGGCAGATCCCCTGAGG + Intergenic
1047203084 8:122782415-122782437 CAAACGGGGCAGGTCCCGCGGGG + Intronic
1047518327 8:125574813-125574835 CCAACAGGGCACCTCCTATGAGG - Intergenic
1053327136 9:37164207-37164229 CGAACTGGGCAGATCACTTGAGG + Intronic
1054911340 9:70458049-70458071 CCAAGTGGGCAGATCACTTGAGG - Intergenic
1056581500 9:87890242-87890264 TGACCTGGGCAGCTCCAGTGTGG + Intergenic
1056935994 9:90914999-90915021 CCAAGTGGGCCGTCCCCGTGCGG - Intergenic
1060760242 9:126240937-126240959 CCAACCTGGCAGCTGCAGTGAGG - Intergenic
1061350603 9:130061709-130061731 CAAAGTGGGCAGATCCCCTGAGG + Intronic
1185962363 X:4558810-4558832 CCAAGTGGGCAGATCACCTGAGG + Intergenic
1190093612 X:47461640-47461662 CCGACTGGGCAGATCACTTGAGG - Intronic
1192467822 X:71369990-71370012 CCAGGTGGGCAGATCACGTGAGG + Intronic
1195966316 X:110433046-110433068 CCAAGAGGGCTGCTCCCGGGTGG + Intronic
1196491926 X:116277687-116277709 TTAAATGTGCAGCTCCCGTGAGG + Intergenic
1200108920 X:153729170-153729192 GCACAGGGGCAGCTCCCGTGGGG - Intronic