ID: 1076687115

View in Genome Browser
Species Human (GRCh38)
Location 10:132203160-132203182
Sequence GCCCAGTTGGACCTCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076687110_1076687115 -10 Left 1076687110 10:132203147-132203169 CCCCACGGGAGCTGCCCAGTTGG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1076687115 10:132203160-132203182 GCCCAGTTGGACCTCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076687115 Original CRISPR GCCCAGTTGGACCTCAGTGT GGG Intronic
No off target data available for this crispr