ID: 1076687366

View in Genome Browser
Species Human (GRCh38)
Location 10:132204156-132204178
Sequence CCTTCAAGACAGTGGCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076687352_1076687366 21 Left 1076687352 10:132204112-132204134 CCTCCTGCCCGCTGTCTGCCCAG 0: 1
1: 0
2: 5
3: 43
4: 481
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687351_1076687366 22 Left 1076687351 10:132204111-132204133 CCCTCCTGCCCGCTGTCTGCCCA 0: 1
1: 0
2: 4
3: 55
4: 421
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687350_1076687366 23 Left 1076687350 10:132204110-132204132 CCCCTCCTGCCCGCTGTCTGCCC 0: 1
1: 0
2: 9
3: 72
4: 627
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687355_1076687366 18 Left 1076687355 10:132204115-132204137 CCTGCCCGCTGTCTGCCCAGGGC 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687359_1076687366 2 Left 1076687359 10:132204131-132204153 CCAGGGCAGCTGTGATGAACCCT No data
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687356_1076687366 14 Left 1076687356 10:132204119-132204141 CCCGCTGTCTGCCCAGGGCAGCT 0: 1
1: 0
2: 2
3: 56
4: 463
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687357_1076687366 13 Left 1076687357 10:132204120-132204142 CCGCTGTCTGCCCAGGGCAGCTG 0: 1
1: 1
2: 6
3: 60
4: 493
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data
1076687358_1076687366 3 Left 1076687358 10:132204130-132204152 CCCAGGGCAGCTGTGATGAACCC 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076687366 Original CRISPR CCTTCAAGACAGTGGCACTG GGG Intronic
No off target data available for this crispr